ID: 947202719

View in Genome Browser
Species Human (GRCh38)
Location 2:227629246-227629268
Sequence CTATTTCATAAACTATTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 1, 1: 1, 2: 7, 3: 56, 4: 628}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947202719_947202721 -4 Left 947202719 2:227629246-227629268 CCAAAAAATAGTTTATGAAATAG 0: 1
1: 1
2: 7
3: 56
4: 628
Right 947202721 2:227629265-227629287 ATAGTGGAACCTAAGCCTGATGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947202719 Original CRISPR CTATTTCATAAACTATTTTT TGG (reversed) Intronic
901893736 1:12290825-12290847 ATATTGCATAAAATATTTTTTGG + Intronic
902073605 1:13764364-13764386 CTACTTCATAATCAATTTCTAGG - Intronic
904375413 1:30078542-30078564 CTCTTGCATAAACTATAATTTGG + Intergenic
905781253 1:40711991-40712013 CTAAATCAGACACTATTTTTAGG - Intronic
905992529 1:42351567-42351589 CTATTTTATAGATTATTTTGGGG - Intergenic
906623570 1:47306030-47306052 CTTTTTTAAAAAATATTTTTTGG - Intronic
906762589 1:48389352-48389374 TTATTTCATTAAATAGTTTTTGG - Intronic
907060619 1:51419797-51419819 ATATTTCATTACCTATTTTGAGG - Intronic
907088923 1:51706509-51706531 CAATTTCATTAGTTATTTTTAGG + Intronic
907918478 1:58891967-58891989 TTATTTCAAAAAATATTTCTAGG + Intergenic
908145519 1:61237159-61237181 CTATATCACCAACTATTTTAGGG - Intronic
909045781 1:70707493-70707515 CTTTTTCATAACTTATTTTCAGG + Intergenic
909196361 1:72630131-72630153 CTATTTGTTAAACAATATTTTGG - Intergenic
909291152 1:73885381-73885403 ATATTTCATGAACTCTTTTTTGG - Intergenic
909519696 1:76552951-76552973 AAATTTCATGAAATATTTTTTGG + Intronic
909767995 1:79382248-79382270 CTCTTTCCCAAAGTATTTTTAGG + Intergenic
910215008 1:84834725-84834747 AAATCTCATAAACTGTTTTTTGG + Intronic
910347621 1:86258469-86258491 GTTTTTCTTAGACTATTTTTTGG + Intergenic
910351308 1:86301221-86301243 CTATTTCTTCTACTAATTTTGGG + Intergenic
910375483 1:86564843-86564865 CTATCCCATGTACTATTTTTTGG + Intronic
910473751 1:87583809-87583831 ATATTTCATAAAGTGTTTTGGGG - Intergenic
911422719 1:97664449-97664471 CTATTTCAAATAGTATTTTAAGG + Intronic
911428038 1:97746241-97746263 CTAATTCATATGCTATTATTAGG + Intronic
911502200 1:98701433-98701455 CTATGGCATAAACTAGTTATGGG - Intronic
912079720 1:105920073-105920095 CTATTTATAAAACTATTTTTAGG + Intergenic
912151300 1:106861926-106861948 GTATTTTATAACTTATTTTTTGG - Intergenic
913520391 1:119640082-119640104 CTATTTAAAAAACTAATATTAGG - Intronic
914407164 1:147387793-147387815 GTATTTCATTAATTGTTTTTTGG + Intergenic
914409290 1:147410014-147410036 ATATTTCAAACACTAATTTTAGG - Intergenic
915336154 1:155143338-155143360 CTAGTTCAACAAATATTTTTCGG - Intergenic
915435225 1:155900431-155900453 CTCTTCCATACACTGTTTTTGGG + Exonic
915898293 1:159828132-159828154 CCATTTGAAAAATTATTTTTGGG - Intronic
916820958 1:168398371-168398393 ATATTTCTTAAACATTTTTTAGG + Intergenic
916914120 1:169387305-169387327 CTAGTACATAAAATATCTTTGGG - Exonic
917083298 1:171279291-171279313 CTATTTCTACAACTATTATTAGG - Intronic
917408319 1:174732883-174732905 CTATTTAATAAACTGTTTGGGGG + Intronic
918893721 1:190312549-190312571 CTATTTCATTTCCTATTTTGAGG - Intronic
919022607 1:192126632-192126654 ATCTTTCAAAAACAATTTTTTGG - Intergenic
919047499 1:192471741-192471763 CTATGTTATAAACTCTCTTTTGG + Intergenic
919285956 1:195560095-195560117 ATATTCCATCAACTATTTTTAGG - Intergenic
919413121 1:197271712-197271734 CTTTATAATAAACTCTTTTTGGG + Intronic
919570847 1:199245015-199245037 CTTTTTCTAAACCTATTTTTGGG + Intergenic
920663902 1:207945218-207945240 GTATTTTATAAGCAATTTTTTGG + Intergenic
920798679 1:209165837-209165859 TTATTTCATAAAAGATTGTTGGG - Intergenic
921514552 1:216073704-216073726 CTAATTCAAATATTATTTTTTGG - Intronic
923418474 1:233788980-233789002 GTCTTTCATAAGCTATTTCTTGG - Intergenic
924315849 1:242795554-242795576 TTATTTCATTGATTATTTTTTGG + Intergenic
924352325 1:243128164-243128186 GTATTTCTTAAAATATTGTTAGG - Intronic
924471711 1:244348741-244348763 CTGTCTCAAAAACAATTTTTTGG - Intergenic
1064631402 10:17316981-17317003 CTATTTAAAAAGATATTTTTGGG + Intergenic
1064714267 10:18160211-18160233 CTCATTCATATATTATTTTTAGG + Intronic
1064826999 10:19415340-19415362 CAGTATCATTAACTATTTTTAGG - Intronic
1065375206 10:25032617-25032639 CTAATTCTTGAACTATTTTAGGG + Intronic
1065381854 10:25098826-25098848 TTATTTCATATATTATTTTACGG - Intergenic
1066184010 10:32991273-32991295 CTATTTCAAAAATTATCTTGAGG - Intronic
1067023749 10:42826160-42826182 CTATTTGCTAAAATTTTTTTAGG + Intronic
1067857520 10:49807958-49807980 CTATTTGCTAAGATATTTTTAGG + Intergenic
1068845531 10:61668658-61668680 CTATTTTATTAACTATTCTAAGG + Intronic
1068979615 10:63048278-63048300 CTATTTAAAAAAATTTTTTTTGG - Intergenic
1069248348 10:66237140-66237162 ATATTTCATATTCTTTTTTTGGG - Intronic
1069281357 10:66658690-66658712 CTCTTTTCTAAAATATTTTTTGG + Intronic
1069330195 10:67282957-67282979 TTTTTACATAGACTATTTTTAGG - Intronic
1070910588 10:80114589-80114611 TTATTTCAAAAATTATCTTTTGG + Intergenic
1071053306 10:81477651-81477673 ATATTTAATATACCATTTTTTGG - Intergenic
1071097292 10:81992173-81992195 TTATTTTTTAAACTATTATTTGG - Intronic
1071591883 10:86882640-86882662 GTATTTTAAAAACTACTTTTAGG + Intronic
1071800996 10:89060180-89060202 CTATTTAATAAAGTACTTATTGG - Intergenic
1072019979 10:91389053-91389075 CATATTCATAAACAATTTTTAGG - Intergenic
1072134470 10:92530898-92530920 TTATTTTATAAATTAGTTTTGGG - Intronic
1072751343 10:97981738-97981760 CATTTTCATAAACTATTAGTGGG - Intronic
1073787590 10:106907267-106907289 GTATGTCATAAAATATTTATTGG - Intronic
1073825677 10:107317754-107317776 CTTTTTAAAAAATTATTTTTAGG - Intergenic
1074133261 10:110603611-110603633 CTATTTCATCAAGAATTTTAAGG - Intronic
1074463526 10:113661410-113661432 CTATCTCATACACAGTTTTTTGG + Intronic
1075836181 10:125454676-125454698 CTATTCAATACACTATTTATTGG - Intergenic
1076496374 10:130900216-130900238 CAATTTCAAGAACTGTTTTTTGG + Intergenic
1077814475 11:5672531-5672553 AAATTTTAAAAACTATTTTTGGG - Intronic
1077949943 11:6945634-6945656 CTTTTTCTTAAAACATTTTTAGG + Intronic
1078169476 11:8918255-8918277 CAATGTCATTAACTATTTATTGG - Intronic
1078225355 11:9386714-9386736 GTATTTCACAAGCTAGTTTTTGG + Intronic
1079068164 11:17316816-17316838 CCCTTTCTTAAACTATTTTCTGG - Intronic
1079534770 11:21500327-21500349 TTATTACAGAAAATATTTTTGGG - Intronic
1079624639 11:22601450-22601472 TTATTTCTTAGAATATTTTTTGG - Intergenic
1079659990 11:23025273-23025295 CTATTTCATGAAATATGCTTTGG + Intergenic
1079687521 11:23378807-23378829 TTATTTTTTGAACTATTTTTTGG + Intergenic
1079700850 11:23544462-23544484 TTATTTAATAGACTATTTTTAGG - Intergenic
1079874645 11:25841581-25841603 CCATTTCACAAAATATGTTTGGG - Intergenic
1079919501 11:26414911-26414933 CTAAATCATGAACAATTTTTCGG - Intronic
1079929888 11:26544937-26544959 CTCTTTCATAAACTTTCTCTTGG - Intronic
1079989011 11:27227742-27227764 CAATTTGAAAAACTTTTTTTGGG + Intergenic
1080511711 11:32981301-32981323 CTATTTTCTAAAATATTTTGAGG - Intronic
1080679762 11:34463455-34463477 CTATTCCGTAAAGTGTTTTTAGG - Intronic
1080733499 11:34985544-34985566 CTATTCGATGTACTATTTTTTGG - Intronic
1081402860 11:42662828-42662850 CTATTTAATAAATTTATTTTGGG - Intergenic
1081463465 11:43294105-43294127 ATATTTCATTTACTATTTTAAGG - Intergenic
1081507154 11:43730618-43730640 CTGTTTATTAAACTATCTTTTGG + Intronic
1081827474 11:46070765-46070787 GTATTCCATAAATTATCTTTTGG - Intronic
1081923025 11:46797091-46797113 CTCTTTCAAAAATTCTTTTTGGG + Intronic
1082224161 11:49682321-49682343 CTATTTCATAAACTATGTCCAGG + Intergenic
1084767428 11:71321889-71321911 GCATTTCATAAACTATTCTTTGG + Intergenic
1084969289 11:72761453-72761475 CTATTTTGTAACCTTTTTTTAGG - Intronic
1085211108 11:74779568-74779590 CCATTTTATCTACTATTTTTTGG - Intronic
1085898151 11:80664229-80664251 CTGATTCATAAAATATTTATGGG - Intergenic
1086624887 11:88936873-88936895 CTATTTCATAAACTATGTCCAGG - Intronic
1087036437 11:93760382-93760404 CTATTTAATAAAATAATTTTGGG - Intronic
1087068685 11:94052770-94052792 ATATTGCATTAACTAATTTTTGG + Intronic
1087073001 11:94100159-94100181 CAATTTCTTAAAATATTCTTAGG - Intronic
1087124433 11:94609159-94609181 CTATTTCATAAGGCATTTATGGG + Intronic
1087502005 11:98968344-98968366 ATTTTCCATAAAATATTTTTAGG - Intergenic
1087585938 11:100121714-100121736 CTATTTTATTCACTATTATTAGG - Intronic
1087963102 11:104376512-104376534 TTATTTCAAAAACTAATTTGTGG - Intergenic
1088033238 11:105277802-105277824 CAACTTCATAAACTACTTATTGG + Intergenic
1088734239 11:112713668-112713690 AAATATCATAAATTATTTTTAGG + Intergenic
1088966525 11:114727690-114727712 CTATTTCAGAAATTATTTACTGG + Intergenic
1089477859 11:118780274-118780296 CTTTTTAAAAAACTATGTTTTGG + Intronic
1089523218 11:119079445-119079467 CTATGTAATAAACCATTTTTTGG - Intronic
1089980686 11:122769664-122769686 CTTTTTCATAAAGTAGTTTTAGG - Intronic
1090553717 11:127851224-127851246 CTAGTTCACCCACTATTTTTTGG + Intergenic
1091072601 11:132582243-132582265 TTATTGAATAAACTGTTTTTAGG - Intronic
1091413598 12:260763-260785 ATATTTTATAAAGTATTTATAGG + Intronic
1092324453 12:7514941-7514963 CTATTTCCATAAATATTTTTGGG - Intergenic
1093020588 12:14199830-14199852 CTTTGTTATAAACTATTTTGGGG - Intergenic
1093328570 12:17808910-17808932 CTATTTCAGAAAATATCTTGGGG + Intergenic
1093534564 12:20208289-20208311 ATATTTGTTAAACTATTTGTTGG + Intergenic
1093586173 12:20839752-20839774 CTGTTTCATATTCTATTTTTGGG + Intronic
1093589462 12:20883396-20883418 ATATTTCAAAAACTATTTTTAGG + Exonic
1093603088 12:21054430-21054452 ATATTTCAAAAATTATTTTTAGG + Exonic
1093872672 12:24310930-24310952 GTATTTCAGGAACTACTTTTCGG + Intergenic
1094104014 12:26789675-26789697 CTATTTCAAAAATTATACTTAGG + Intronic
1094115582 12:26908864-26908886 CTATTTCATATAATATTTCCAGG + Intronic
1094285903 12:28793294-28793316 CTATTTAATAGACTACATTTAGG - Intergenic
1095654558 12:44653739-44653761 CAATTTAACAAACAATTTTTTGG + Intronic
1096202896 12:49698447-49698469 TTAGTTTATAAAGTATTTTTAGG - Intronic
1097453056 12:59759659-59759681 ATATTTTATAAAATATTTGTAGG + Intronic
1098011451 12:66057457-66057479 CAATTTCCTAAACTCTTATTTGG - Intergenic
1098746759 12:74246778-74246800 TTACTTCAAAAACTACTTTTTGG - Intergenic
1099070060 12:78034822-78034844 CAATTTTGTAAAGTATTTTTTGG - Intronic
1099281316 12:80651369-80651391 CTTTTTTATAAACTCTTTTCTGG - Intronic
1099609317 12:84847246-84847268 CTATTCCAAAAACTTTTTTATGG + Intergenic
1099805198 12:87509755-87509777 ATATATTAGAAACTATTTTTTGG - Intergenic
1100284042 12:93147606-93147628 CTATTCCAAAAGCTATTTGTAGG - Intergenic
1100376731 12:94023397-94023419 CTATTTCATAACCCATAATTAGG + Intergenic
1100394480 12:94172715-94172737 CTATATCATATTCTATTATTTGG + Intronic
1100725260 12:97401474-97401496 CTGTCTCAAAAAATATTTTTTGG + Intergenic
1100789575 12:98115704-98115726 CTATTTTAGGAACTATTTTTTGG - Intergenic
1100866030 12:98857713-98857735 ATATTTCAAGAACTATTTATGGG + Intronic
1101096742 12:101349762-101349784 TTATTTCTTTAAATATTTTTGGG + Intronic
1102845314 12:116175124-116175146 TTTTTTCTTAAATTATTTTTTGG - Intronic
1103105897 12:118224675-118224697 CTGTTTTATAAATTATCTTTGGG - Intronic
1105684684 13:22768632-22768654 GTTTTTAATAAACTATTTTATGG + Intergenic
1106948209 13:34852629-34852651 CTATTTCACAAACTTTTCTTGGG + Intergenic
1107539058 13:41368793-41368815 CTTTTTCATAAATTATATTATGG - Intronic
1107855229 13:44608513-44608535 CTATTTTATTGACTTTTTTTTGG - Intergenic
1108301719 13:49084061-49084083 CTAGTTGATATACTATTTATAGG - Intronic
1108515423 13:51197569-51197591 CTATATCATAAACTATCTTTTGG + Intergenic
1109780508 13:67104954-67104976 ATATTGCAAAAACTATTTTAGGG - Intronic
1109790082 13:67235037-67235059 CTGTTTCCTGAATTATTTTTGGG - Intergenic
1110054631 13:70951448-70951470 CTAATTTATAAATTATTTTAAGG - Intergenic
1110127214 13:71960584-71960606 CTATTTCCTAATTCATTTTTAGG + Intergenic
1110299693 13:73912043-73912065 CTATTTTAGAAACTACCTTTTGG - Intronic
1110814894 13:79850267-79850289 TTATTTTGTAAATTATTTTTGGG + Intergenic
1110896754 13:80762408-80762430 ATATTTTATGAACTATTTTATGG + Intergenic
1110937549 13:81310963-81310985 CTAGTGCAGAAATTATTTTTTGG + Intergenic
1111008989 13:82287237-82287259 ATATTTTATTAACTATTTCTGGG - Intergenic
1111118869 13:83820268-83820290 TTATTTCATACATTATTTTAAGG - Intergenic
1111352961 13:87056654-87056676 CTATTTCAGAGACCATTTATTGG - Intergenic
1111516667 13:89342118-89342140 TTATTTCATAAACTATTTTTTGG - Intergenic
1111521077 13:89405328-89405350 TTATTTAATAAAATATTTTTGGG + Intergenic
1111683364 13:91471067-91471089 ATATTTAATAGACTATCTTTTGG + Intronic
1112977029 13:105332728-105332750 GTATTTCCTGAACAATTTTTAGG - Intergenic
1112977239 13:105335745-105335767 GTATTTCCTGAACAATTTTTAGG - Intergenic
1113232459 13:108228889-108228911 CTATCGCATCAACTTTTTTTGGG + Intronic
1113559612 13:111267720-111267742 CTATTTCATGCACTATTTGAAGG - Intronic
1113680083 13:112237698-112237720 CCATTTCATAACCGATTTTCAGG + Intergenic
1113822711 13:113226579-113226601 CTTTGTCCTAAACTACTTTTTGG + Intronic
1114766115 14:25372543-25372565 CAAATTCATACAATATTTTTTGG + Intergenic
1114920432 14:27320432-27320454 AAATTTCATAAACTCTTTCTTGG + Intergenic
1114998804 14:28394950-28394972 TTATTTTATAACCTTTTTTTTGG + Intergenic
1115337214 14:32253842-32253864 CTATTTAAAAAAATATTTCTAGG + Intergenic
1115618170 14:35115941-35115963 GTTTTCCATAATCTATTTTTCGG + Intronic
1115685478 14:35791954-35791976 CTATTATATAAATAATTTTTAGG - Intronic
1115768134 14:36644989-36645011 GCATTTGATAAACTATTTTATGG - Intergenic
1116132158 14:40868445-40868467 CAATTGCTTAAAATATTTTTGGG + Intergenic
1116466414 14:45238657-45238679 CTAATTTTTAAACTTTTTTTTGG - Intronic
1116495788 14:45558563-45558585 TTATTTCATAAAATATTTTAAGG - Intergenic
1116575139 14:46564856-46564878 CTCTTTAATCAAGTATTTTTGGG + Intergenic
1116596059 14:46846827-46846849 CTCTTTATTAAACTATTCTTTGG - Intronic
1116751349 14:48889482-48889504 CTATTTCTAAACCTATATTTGGG - Intergenic
1117066423 14:52016530-52016552 ATATGTCAAAAACTCTTTTTAGG + Intronic
1117130386 14:52680841-52680863 CAATGTCATATACTATTTATGGG - Intronic
1117177540 14:53160380-53160402 ATGTTTCAAAAAATATTTTTGGG + Intergenic
1117385083 14:55203906-55203928 TTTTTTAAAAAACTATTTTTAGG + Intergenic
1117441497 14:55763784-55763806 CTATTTCATACACATTTATTAGG + Intergenic
1118090444 14:62470165-62470187 CTAGGTCATAAACTTTTTTGAGG + Intergenic
1118481411 14:66170883-66170905 TTTATTCATAAACAATTTTTAGG - Intergenic
1119057046 14:71433238-71433260 CTATTTCCTGAATTATCTTTTGG + Intronic
1119763645 14:77173706-77173728 TTATTTCTTAAAAAATTTTTTGG - Intronic
1120193092 14:81456948-81456970 ATATTTCACTAACTATATTTTGG + Intergenic
1120596935 14:86451509-86451531 CTTTTTCAACAACTACTTTTTGG + Intergenic
1120933332 14:89870509-89870531 CTATTACATAATACATTTTTGGG - Intronic
1121970516 14:98351671-98351693 CTTTTTCATTAACAATGTTTTGG + Intergenic
1202846010 14_GL000009v2_random:176131-176153 CTATTGGTTAAAATATTTTTGGG - Intergenic
1123424893 15:20163193-20163215 CTATTTGCTAAAATTTTTTTAGG + Intergenic
1123534117 15:21169724-21169746 CTATTTGCTAAAATTTTTTTAGG + Intergenic
1123737924 15:23203123-23203145 ATATATCAGCAACTATTTTTTGG - Intergenic
1123912384 15:24980883-24980905 ATACTTCATAACCTATTTTAAGG - Intergenic
1124289133 15:28431792-28431814 ATATATCAGCAACTATTTTTTGG - Intergenic
1124294089 15:28485518-28485540 ATATATCAGCAACTATTTTTTGG + Intergenic
1124498722 15:30207676-30207698 CCATTTCATAAAATATATGTAGG - Intergenic
1124744857 15:32331000-32331022 CCATTTCATAAAATATATGTAGG + Intergenic
1125256196 15:37766309-37766331 GTTTATTATAAACTATTTTTTGG - Intergenic
1125422593 15:39519541-39519563 CACTTTCATAATCTGTTTTTAGG + Intergenic
1126154272 15:45550628-45550650 CTATTTAAAAAAATTTTTTTAGG - Intergenic
1126344023 15:47674224-47674246 CTATTTCAGAAATCAGTTTTAGG + Intronic
1126546964 15:49884689-49884711 CAATTTTATATGCTATTTTTTGG + Intronic
1126920396 15:53515513-53515535 ATATCTCTAAAACTATTTTTAGG + Exonic
1126936110 15:53709684-53709706 CTATTTCTAAAATTATTTGTGGG - Intronic
1126985337 15:54300311-54300333 CAAATTCATCAACTATTTCTTGG - Exonic
1127935950 15:63638301-63638323 CCATTTCATAATCTATTATGAGG - Intronic
1131577570 15:93606946-93606968 GTATTTTATAAACTCTTTTGGGG + Intergenic
1132266772 15:100480509-100480531 CTCTTTCAAAACCTACTTTTAGG - Intronic
1134215323 16:12312713-12312735 CTATTGCTTAAACAATTTATAGG + Intronic
1135496057 16:22952209-22952231 TTAATTCATAAAGTAATTTTGGG - Intergenic
1136188107 16:28599983-28600005 TTATTTTATTAACTATTTCTTGG + Intergenic
1136190579 16:28612977-28612999 TTATTTTATTAACTATTTCTTGG + Intronic
1137867973 16:51920912-51920934 CTATTTCCTAGATTCTTTTTGGG + Intergenic
1138078395 16:54065327-54065349 CTAATTTTTAAACTTTTTTTAGG + Intronic
1138096024 16:54212687-54212709 CCAATTCATAAACTATTGTAAGG + Intergenic
1138618147 16:58188682-58188704 TTATGTAAGAAACTATTTTTAGG + Intronic
1138870982 16:60885588-60885610 CTTTTAAATAGACTATTTTTAGG + Intergenic
1139199701 16:64961565-64961587 CTGTTTTATAAATTATTATTAGG + Intronic
1139806597 16:69570619-69570641 ATAGTTTATAAACTATTTCTTGG + Intronic
1141080800 16:81050505-81050527 CTATTTTAAAAATTATTTTCTGG - Intergenic
1144137822 17:12315303-12315325 TTATTTGAAAAATTATTTTTTGG + Intergenic
1145032387 17:19514621-19514643 CTATTTTAAAAAATATTTTTTGG + Intronic
1146702346 17:34972220-34972242 CTATTTCTTAAAGAAATTTTTGG - Intronic
1147411485 17:40255924-40255946 CTAATTTAAAAACAATTTTTGGG - Intronic
1148671134 17:49411099-49411121 CTATTTCTAAAACTATTGATAGG - Intronic
1149068425 17:52508477-52508499 CTATTTAATAAATTATAATTGGG - Intergenic
1149157055 17:53643955-53643977 CTATTTTTCAAAATATTTTTAGG + Intergenic
1149300017 17:55296545-55296567 CTTTTTCATTCAATATTTTTTGG + Intronic
1149825131 17:59821441-59821463 GTATTTGAAAAATTATTTTTAGG + Intronic
1149873830 17:60209664-60209686 CTATTTCAACAAATATATTTTGG + Intronic
1150087610 17:62286924-62286946 CTATTTCAACAAATATATTTTGG + Intergenic
1151003576 17:70406834-70406856 CCATTTCTTAACCTATATTTGGG + Intergenic
1151141894 17:72001320-72001342 CTATTTTAAAAAGTGTTTTTCGG + Intergenic
1151610340 17:75169681-75169703 CTAATTTAAAAAATATTTTTAGG - Intergenic
1152674861 17:81634545-81634567 CTAATTCCTAACCTATTTCTAGG + Intronic
1153080465 18:1217858-1217880 CTGTTTGATAAACTATTTCCTGG + Intergenic
1153574080 18:6503470-6503492 CTATTTCTTAAACTGGGTTTTGG + Intergenic
1153600283 18:6774341-6774363 CTTTTTTAAAATCTATTTTTAGG + Intronic
1154380076 18:13841488-13841510 CTATTTCAAAAGGTATATTTAGG - Intergenic
1154950061 18:21201359-21201381 GAATTTTATAAACTATCTTTCGG - Intergenic
1155098777 18:22587622-22587644 CTATCTCATAAACAACTTTTGGG + Intergenic
1155329735 18:24702988-24703010 CTATTTTATAAAATTTTCTTGGG - Intergenic
1156003671 18:32414831-32414853 TTATTTCTTATACTAATTTTGGG - Intronic
1156284536 18:35678398-35678420 CTATTTCATGAAATACTCTTTGG + Intronic
1156445068 18:37230597-37230619 CTATTTGATAAATAATGTTTGGG - Intronic
1156691676 18:39714867-39714889 CTATTTCATTATTTATCTTTAGG + Intergenic
1157027665 18:43865762-43865784 CTATTTCTTTAAATCTTTTTGGG - Intergenic
1157948516 18:52008134-52008156 CTATTTCATAAAACATTCATTGG + Intergenic
1158634169 18:59141220-59141242 CTATTTCATCAACCGTGTTTAGG + Intronic
1158835361 18:61325346-61325368 CTATTTTATACTTTATTTTTAGG + Intergenic
1158879087 18:61759272-61759294 CTATTTGCTAGACTATTCTTGGG - Intergenic
1158958227 18:62562983-62563005 CACTTTCATAAACTTTTCTTTGG + Intronic
1159265949 18:66079270-66079292 CTACTTCATCAACCAATTTTAGG - Intergenic
1159575446 18:70170558-70170580 CAATTACAAAAACTATTATTTGG + Intronic
1160132610 18:76241516-76241538 CTATTTCTTAAATTGTTATTGGG - Intergenic
1160338731 18:78067842-78067864 GTAATTCATAAAATATTTTTTGG + Intergenic
1164038881 19:21477095-21477117 CTATTTCATCCACTTTTTTATGG - Intronic
1165816168 19:38643711-38643733 CTGTTTCATAAACTAGGTTGAGG + Intergenic
1167833043 19:52042651-52042673 ATATTTCAAAAACTATGTATAGG - Intronic
1168410101 19:56134474-56134496 CCATTTCATATACTATTTTTGGG - Intronic
1168525529 19:57085649-57085671 CTGTCTCATAAGCTATGTTTGGG + Intergenic
925577365 2:5374279-5374301 CTTTTTCAGAAACAACTTTTAGG - Intergenic
926021010 2:9495745-9495767 CTAATTTATAAAATATTTCTTGG + Intronic
926901548 2:17756007-17756029 CTATTTCAGAAAGTATTGCTTGG - Intronic
927542409 2:23925247-23925269 CTATTTAATAGACTATTTTGGGG - Intronic
929336288 2:40750669-40750691 CTCTTTTATAAAATATTTTTGGG + Intergenic
929349555 2:40933053-40933075 CATTTTCTTTAACTATTTTTGGG + Intergenic
929690624 2:44069579-44069601 CTTTTTTAAAAACTTTTTTTTGG + Intergenic
929964291 2:46521992-46522014 GTCTTTCAAAAAGTATTTTTTGG + Intronic
930464205 2:51724663-51724685 TTATTTCATTAAATATTTATTGG + Intergenic
930880876 2:56269012-56269034 CTTTTCCATAGACTAGTTTTTGG + Intronic
931082070 2:58784835-58784857 CAACTTCATAGACTATTTTCTGG - Intergenic
932750500 2:74368612-74368634 CTATACCATAAACTCTTTGTGGG + Intronic
932991259 2:76790512-76790534 CTATTTCAGAAAGTACTTTGGGG + Intronic
933484913 2:82909110-82909132 CAATTTAATAAAATATATTTAGG + Intergenic
933761186 2:85673384-85673406 CTAGCTCATTAACCATTTTTTGG - Intergenic
934165144 2:89287410-89287432 CTATTACAAAACGTATTTTTGGG + Intergenic
934202129 2:89895052-89895074 CTATTACAAAACGTATTTTTGGG - Intergenic
934458323 2:94193660-94193682 CTATTTGCTAAAATTTTTTTAGG - Intergenic
934686150 2:96323273-96323295 CTATTACATCAACTTTTTCTAGG - Intergenic
935482086 2:103602929-103602951 CAATGTGATAAACTATATTTGGG + Intergenic
935653860 2:105404830-105404852 CTTTTTCACAAACTATTTGTTGG + Intronic
936257703 2:110931083-110931105 CTATTTCCTAATTTATCTTTTGG + Intronic
937186919 2:120052467-120052489 CTTTGTCATTAACTATTTTGTGG + Intronic
937412977 2:121692533-121692555 GTATTTAATATACTATTTTGTGG + Intergenic
937642312 2:124227719-124227741 CTAATTCAAAGAGTATTTTTTGG + Intronic
938838468 2:135133698-135133720 CTACTGCATAAACTATTCTTAGG - Intronic
938873586 2:135508703-135508725 ATATTTTAAAAATTATTTTTAGG - Intronic
939501749 2:142995461-142995483 CTATTTTAGAAAGTAGTTTTAGG - Intronic
939850887 2:147303069-147303091 CTATTTCATAGGCTTTTTGTTGG + Intergenic
939855609 2:147355197-147355219 ATATTTCAGAATCTATTTCTGGG + Intergenic
939966466 2:148615177-148615199 CCCTTTTAGAAACTATTTTTAGG - Intergenic
940603444 2:155889880-155889902 TTATTTATTAAAATATTTTTGGG + Intergenic
940613701 2:156023996-156024018 CTATCTCCTAAACTCCTTTTTGG - Intergenic
940967145 2:159851781-159851803 GCATTTCACAAACTACTTTTTGG - Intronic
940975665 2:159940749-159940771 CTATTTAATAAACTATTTTCTGG - Exonic
941379048 2:164768817-164768839 CTATTTCCTTAACTATTTTTAGG + Intronic
941727126 2:168873144-168873166 GTATTTCAAAAATTATTTTTGGG + Intronic
941800306 2:169652354-169652376 CTGTTTAAAATACTATTTTTTGG - Intronic
942031710 2:171969821-171969843 CTATTTCCTAAACTTTTCTGAGG + Intronic
942150035 2:173066491-173066513 CTAATTCTTAAATTATTTATAGG - Intergenic
942165666 2:173238257-173238279 CTAGTTCATAAAATATCTTGGGG - Intronic
942253628 2:174069609-174069631 CTAATTTATAAATTAATTTTTGG + Intergenic
942375210 2:175329320-175329342 ATCCTTCATAAACTATTCTTGGG - Intergenic
942649486 2:178151480-178151502 ATATTTATGAAACTATTTTTTGG - Intergenic
942741569 2:179186534-179186556 GTATTTCAGAAACAATTATTTGG + Intronic
942897360 2:181073450-181073472 CTATTTTAAAAAATATTTCTAGG - Intronic
942910533 2:181237936-181237958 CTATTTAAAACACTATTTGTAGG + Intergenic
942954087 2:181753738-181753760 CTTTTCCCTAAACTATTATTGGG - Intergenic
943871076 2:193000130-193000152 CTATTAAATAAAATATTTTGTGG - Intergenic
943988370 2:194653685-194653707 ATTTTTCACATACTATTTTTTGG - Intergenic
944012662 2:194992679-194992701 CTTTTTCAAAAAATATTTTAAGG + Intergenic
944344514 2:198645880-198645902 TTATGTCACAAACCATTTTTTGG - Intergenic
944791520 2:203133905-203133927 CTATTTAATAAAGTATTATCTGG + Intronic
945670295 2:212794287-212794309 CTATTTTATAACCTAGTGTTGGG + Intergenic
945804673 2:214475977-214475999 CTATTTCATCAATTGTTTTGCGG - Intronic
946465264 2:219906071-219906093 CTACTTCATAATCTTTATTTGGG + Intergenic
946630424 2:221661675-221661697 AAATTTTATAGACTATTTTTAGG + Intergenic
946797688 2:223372974-223372996 CTATTTAATATTCCATTTTTTGG - Intergenic
946852962 2:223925176-223925198 CCATTTCATAAACATTTTATTGG - Intronic
947138988 2:227003642-227003664 CCATTCCATTGACTATTTTTCGG + Exonic
947202719 2:227629246-227629268 CTATTTCATAAACTATTTTTTGG - Intronic
947277244 2:228406448-228406470 TTGTTTTATAAACTATTTTCAGG - Intergenic
1169569903 20:6894828-6894850 CTATATCATAAACGCTTTTAAGG + Intergenic
1169672242 20:8115382-8115404 CTATTTTGAAAACTTTTTTTGGG - Intergenic
1171284988 20:23929677-23929699 CTATCTCATAAAGTAATTGTTGG - Intergenic
1171873110 20:30546306-30546328 CTATCTCATAAACTAAACTTAGG - Intergenic
1172498386 20:35406187-35406209 TTATTTCTTCAAATATTTTTCGG - Intronic
1173604495 20:44322029-44322051 GTATATCATAAAGAATTTTTGGG + Intergenic
1174745034 20:53053234-53053256 CCATTTCATGAAATATTATTTGG - Intronic
1177677542 21:24321182-24321204 CTATTTCTAAAACTATTGATAGG + Intergenic
1177863244 21:26480149-26480171 CAATTTCATAGAGTATTTCTAGG - Intronic
1177997981 21:28126766-28126788 TTATTGGATAAACTATGTTTGGG - Intergenic
1178080850 21:29063301-29063323 CTATATCATAAATGGTTTTTTGG - Intronic
1178311333 21:31532420-31532442 ATTTTTCCTAAACTATTTTAAGG + Intronic
1178358506 21:31928861-31928883 GAATTTCATAAATTATTTTGAGG + Intronic
1179004142 21:37494999-37495021 CTATAACATAAACTTCTTTTTGG + Intronic
1179328168 21:40370944-40370966 ATAATTCATAAATCATTTTTAGG - Intronic
1180330730 22:11476917-11476939 TTATTTCATAAAGAATTATTTGG - Intergenic
1180750044 22:18118238-18118260 ATATTTGATAATCTATTATTCGG + Intronic
1181357887 22:22312765-22312787 CTATTTGCTAAAATTTTTTTAGG + Intergenic
1182409312 22:30169349-30169371 TTATTTGATAAATTTTTTTTGGG - Intronic
1182753410 22:32659441-32659463 CTATTTCACAAACTCTTCCTGGG + Intronic
950481325 3:13246060-13246082 CTCTTTCAGAAACTATTTGTGGG + Intergenic
951393546 3:22137095-22137117 CTATTACCTAAACTAATATTTGG + Intronic
951489024 3:23247774-23247796 TTATTTCATAAGCAATTTCTGGG - Intronic
952176019 3:30864158-30864180 CTCTTTCTTACTCTATTTTTAGG - Intronic
952478229 3:33733098-33733120 CTCTTTCCTAAACTAATTTATGG - Intergenic
953142005 3:40237809-40237831 ATATTTCACACACTGTTTTTTGG - Intronic
953525824 3:43689509-43689531 CTAATTCATAAAATATTTTAGGG - Intronic
955206196 3:56898183-56898205 CTATTTTAAAAAACATTTTTAGG + Intronic
955660420 3:61292991-61293013 CTATATGTTGAACTATTTTTAGG + Intergenic
956056593 3:65305275-65305297 CTATTTTTAAAACTTTTTTTAGG + Intergenic
957161468 3:76615615-76615637 ATATTCCAAAAATTATTTTTTGG - Intronic
957401589 3:79722408-79722430 GTATTTAGTAAACTTTTTTTGGG - Intronic
957480450 3:80786338-80786360 CTATATTTTAAACTAGTTTTAGG + Intergenic
957671937 3:83316499-83316521 ATATTTTATAAACAACTTTTTGG + Intergenic
957993882 3:87663118-87663140 CTATTTCTTAACTTTTTTTTAGG - Intergenic
958061565 3:88489260-88489282 ATCTTTCATGAAATATTTTTAGG + Intergenic
958167204 3:89891826-89891848 TTATTTCATAAACTCTTTGAGGG - Intergenic
958597886 3:96253504-96253526 CTATTTCATAAATTGCTGTTAGG + Intergenic
959352183 3:105279667-105279689 TTACTTCATGAACTACTTTTAGG + Intergenic
960299788 3:115987955-115987977 CAATTTTATAAACTATATGTAGG + Intronic
960467749 3:118018465-118018487 ATATTTTATTAACTAATTTTAGG + Intergenic
960530908 3:118763516-118763538 CTCTTTCTTAAACCCTTTTTAGG - Intergenic
960712232 3:120543418-120543440 CTATTTCCTAAAATTTTTCTTGG + Intergenic
961587852 3:127948784-127948806 CTATTTCATAAGATAATCTTAGG - Intronic
962359968 3:134731350-134731372 CTAATTAATGAACTATTTTTTGG - Intronic
962415825 3:135181041-135181063 CTACTTCATATATTATCTTTAGG + Intronic
962508160 3:136069614-136069636 TTATTTCTTTAACTTTTTTTAGG - Intronic
962778917 3:138692563-138692585 CTATTTTTTACACTATTTATAGG - Intronic
963135323 3:141898008-141898030 CTGTTTAAAAAACTATTTGTTGG - Intronic
963386706 3:144605067-144605089 CTATTACACAAATTATTTCTTGG - Intergenic
963541296 3:146592988-146593010 CTAATTCTCCAACTATTTTTAGG - Intronic
963593282 3:147290500-147290522 CTATGTCTTAAACTATGTTTTGG + Intergenic
964081432 3:152763386-152763408 CTACTTCATAAAATAATTATAGG + Intergenic
964203660 3:154146470-154146492 AAATTTCATAAACTATGTTTTGG + Intronic
964311435 3:155397543-155397565 TTATTTTAAAAACCATTTTTTGG + Intronic
965057409 3:163739706-163739728 ATATTTCATTAATTATTTTCTGG - Intergenic
965505580 3:169511459-169511481 CTTTTTTAAAAAGTATTTTTAGG + Intronic
965995105 3:174872212-174872234 CTAACTGGTAAACTATTTTTAGG + Intronic
966441407 3:179949150-179949172 CTATTTTAAAAACTTGTTTTGGG + Intronic
966604040 3:181804416-181804438 CTTCTTCATAAAATATTATTTGG + Intergenic
967487351 3:190048491-190048513 TTATTTTCAAAACTATTTTTTGG - Intronic
967528991 3:190527796-190527818 CTATTTGATAAATTATTTTAAGG + Intronic
967653115 3:192010837-192010859 GTCATTCATAAACTAGTTTTTGG - Intergenic
967672693 3:192257602-192257624 CTATTTCATGAAAAATATTTTGG + Intronic
970017122 4:11524377-11524399 TTTTTAAATAAACTATTTTTTGG + Intergenic
970539049 4:17059320-17059342 CTGTTTCATCTGCTATTTTTTGG - Intergenic
971664570 4:29465568-29465590 TTAATTCTTATACTATTTTTGGG - Intergenic
972145178 4:36015137-36015159 TTATTTAAGAAACTATTATTTGG + Intronic
972827443 4:42776436-42776458 CCATTTTATAAAATATTTTAAGG - Intergenic
972909117 4:43792022-43792044 CTATTTGAGCAAGTATTTTTTGG - Intergenic
972939446 4:44179561-44179583 CTATTTAATACAATATCTTTAGG + Intronic
973005494 4:45000651-45000673 CTAATTCATAAATTACTTTAGGG - Intergenic
973295983 4:48521277-48521299 CTCTATCATAAAATATTTTAGGG + Intronic
974150710 4:58005517-58005539 CAATTTTATAAAATATATTTTGG - Intergenic
974321984 4:60362357-60362379 CTATTCCACAAACTTTATTTTGG + Intergenic
974386429 4:61206297-61206319 TTATTTTGAAAACTATTTTTGGG + Intronic
974853902 4:67436491-67436513 TTTTTTCATAAAATATTTTATGG - Intergenic
975039513 4:69727574-69727596 TTATTTCACAAAGTAATTTTTGG + Intronic
975309946 4:72892580-72892602 CAATTTAATCATCTATTTTTTGG + Intergenic
975569434 4:75798611-75798633 CTCTTCTATAATCTATTTTTAGG - Intronic
977019008 4:91735755-91735777 ATATTTAAGAAATTATTTTTAGG + Intergenic
977263762 4:94830169-94830191 ATAAATAATAAACTATTTTTTGG + Intronic
977334517 4:95679578-95679600 CTTTTTCATAACCTATGTCTTGG - Intergenic
977378613 4:96240466-96240488 CTATTTCAATAACTGCTTTTTGG - Intergenic
977479165 4:97552337-97552359 TTATTTTATAAACACTTTTTTGG - Intronic
977529805 4:98186876-98186898 CTATTTCATAGATTATTTTGAGG - Intergenic
978223208 4:106302708-106302730 CTATTTCCAAAACCATTCTTTGG - Intronic
978298459 4:107237025-107237047 CAATTTCAAAAACTTTCTTTTGG - Intronic
979102332 4:116634763-116634785 ATATTTAAAAAACAATTTTTGGG - Intergenic
979842210 4:125456296-125456318 CTATATCATAAACTCTTTCTAGG + Intronic
980226056 4:129987380-129987402 TTATTACACAAACTATTTTCAGG + Intergenic
980384653 4:132071739-132071761 TTATTTCATATATTATTTGTGGG + Intergenic
980476159 4:133319590-133319612 CATTTTCATAGACTATATTTTGG + Intergenic
980622460 4:135325858-135325880 CTATTTCATAAAGTGTTTTTAGG + Intergenic
981031655 4:140131581-140131603 CCATTTCAAAAACTAATTCTGGG + Intronic
981129038 4:141137802-141137824 ATATTTTAAAAACTATTTTAGGG - Intronic
981181157 4:141746847-141746869 ACATTCAATAAACTATTTTTTGG - Intergenic
981355807 4:143787801-143787823 ATATTTTAAAAACTATTTGTTGG - Intergenic
981515241 4:145600940-145600962 CTACTTCACCAACTATTTTCTGG + Intergenic
981589773 4:146347133-146347155 CCATTCCCTAAACCATTTTTAGG - Intronic
982007221 4:151075300-151075322 CTAATTCAAAAAAAATTTTTTGG + Intergenic
982561988 4:156940345-156940367 ATATTTCATAACCTATATTTAGG - Intronic
983046497 4:162993199-162993221 CTATTCCATGAACTCTTTTTTGG + Intergenic
983329036 4:166300835-166300857 CTATGCCATAAACAAATTTTGGG + Intergenic
983805936 4:171991322-171991344 ATATTTCAGAAAATAATTTTTGG - Intronic
983843781 4:172490375-172490397 TTATTTTATAAACTATTTTTGGG - Intronic
983970983 4:173874093-173874115 CTGTTTCCTAACTTATTTTTGGG + Intergenic
984104687 4:175530574-175530596 CTATTTCTTGAACTGTTTTGAGG - Intergenic
984413801 4:179431593-179431615 CTATTTTATAAACAACTTTGAGG - Intergenic
984881844 4:184416717-184416739 CTTTTTTTTGAACTATTTTTTGG - Intronic
987586079 5:19858407-19858429 GTTTGTCATAAACTATTTTAGGG + Intronic
987753726 5:22073315-22073337 CAATTTCCTAAATTATTCTTCGG + Intronic
988033041 5:25790932-25790954 CTATTTGTTAACCTATTTGTAGG - Intergenic
988159181 5:27496988-27497010 GTCTTTCATAAATTAGTTTTTGG - Intergenic
988356284 5:30179956-30179978 CTATTTTATAAACTCATTGTTGG - Intergenic
989018003 5:36963425-36963447 ATATTTCATAATCTGGTTTTGGG - Intronic
989477108 5:41886819-41886841 CTAATTCAAAAACTATTTAAAGG - Intergenic
989777620 5:45227798-45227820 CTATATTATAAACTCTTTTGAGG + Intergenic
990038909 5:51355934-51355956 CTATCTGACAGACTATTTTTGGG - Intergenic
990131538 5:52592107-52592129 TTATTTCATAAACTTTTCTAAGG + Intergenic
990426174 5:55691515-55691537 CTATTTCACAATCTGTTTGTAGG + Intronic
990697879 5:58442638-58442660 CTTCTTCATAAACCACTTTTGGG - Intergenic
990855186 5:60258187-60258209 CTGTTTCATACACTATCCTTGGG + Intronic
992180273 5:74189497-74189519 ATAATTAATAAACTATTTTTAGG + Intergenic
992401903 5:76419287-76419309 CTAATTAAAAAAATATTTTTTGG + Intronic
992560173 5:77944235-77944257 GTATTTTAAAAACTGTTTTTTGG + Intergenic
993536270 5:89090389-89090411 CCAGTTCATAAATTATTTATTGG + Intergenic
993662292 5:90652971-90652993 CTAATTCATATACTCTTTTCAGG + Intronic
993724286 5:91350554-91350576 CTATATCATAAGCTATTAATGGG + Intergenic
993728869 5:91398924-91398946 CCATTTCATATAGTCTTTTTTGG - Intergenic
993761986 5:91806710-91806732 CTATGTAATAAAATATTTTGGGG + Intergenic
994512988 5:100731418-100731440 ATAGTTAATATACTATTTTTTGG - Intergenic
994689327 5:102997646-102997668 CTATTTCATTATCCACTTTTTGG - Intronic
994852954 5:105079835-105079857 ATATTTGATAATTTATTTTTTGG + Intergenic
994894939 5:105691192-105691214 ATATTTTATAATTTATTTTTGGG + Intergenic
994945780 5:106387262-106387284 GAATTTCTTAAACAATTTTTGGG + Intergenic
995407511 5:111816163-111816185 CTTATTCAAAAACTTTTTTTTGG - Intronic
996058454 5:119006346-119006368 TTATTTATTAAACTATTTTGTGG - Intergenic
996074918 5:119181144-119181166 CCATTACATAAATTATTTTGGGG + Intronic
996494657 5:124139938-124139960 CTGTTTTATAATATATTTTTTGG - Intergenic
996548310 5:124704634-124704656 CTATTTCGTAAAATAATTATTGG + Intronic
997346676 5:133197200-133197222 AACTTTCATAAACTTTTTTTTGG - Exonic
997989711 5:138534033-138534055 CAATTGCATAAACTAATTTCAGG - Intronic
998868767 5:146532064-146532086 TTAATACATAAAATATTTTTGGG + Intergenic
1000446567 5:161329778-161329800 CTACTTCATAAACAGTATTTAGG + Intronic
1000629433 5:163574738-163574760 TTATTTCATCAACTGTTATTAGG + Intergenic
1000887554 5:166764446-166764468 TTTTTTCATAATCCATTTTTGGG + Intergenic
1002463733 5:179391707-179391729 CTCTTTTATAACCTTTTTTTGGG - Intergenic
1003001305 6:2336662-2336684 CTATTTAATAAACTAATGCTGGG + Intergenic
1003739431 6:8919178-8919200 ATATTTCATAAGCAATCTTTAGG + Intergenic
1003774552 6:9345802-9345824 CTATTTTATAGATTATTCTTTGG - Intergenic
1003943058 6:11047187-11047209 CTATTTAATAAAATATTGGTGGG - Intergenic
1004070597 6:12293572-12293594 CTATTTAGTTAACTATTTGTGGG - Intronic
1004754626 6:18598437-18598459 CCATTTCATAGTTTATTTTTAGG - Intergenic
1004959490 6:20770648-20770670 CTACTTCATACATTATTTTTAGG + Intronic
1006478255 6:34272081-34272103 CTCTTTAAAAAACAATTTTTTGG - Intergenic
1007058651 6:38915278-38915300 CAATTTCATCCACAATTTTTTGG - Exonic
1008213309 6:48752857-48752879 CTGTTTTAAAAACTATTTTTTGG + Intergenic
1008798660 6:55339559-55339581 CTATTTAAAAAACTTCTTTTTGG - Intronic
1008902403 6:56636472-56636494 CTTTTTCATAATTTATTGTTAGG - Intronic
1008947455 6:57113923-57113945 CTGTTTTATAAAAAATTTTTCGG - Intronic
1009465609 6:63965079-63965101 CTATTTCAAAAAATAACTTTGGG + Intronic
1009515337 6:64609210-64609232 TTTTTTCTTAAACTATTTTCTGG - Intronic
1009664794 6:66661549-66661571 CTATTTCAAAAATCATTATTGGG - Intergenic
1010393737 6:75366802-75366824 ATATTTCACAATCTACTTTTAGG + Intronic
1011402304 6:86976894-86976916 GTGTTTCAAAAACTACTTTTTGG - Intronic
1011454344 6:87531202-87531224 CTATATCACAAATTAATTTTTGG - Intronic
1011572276 6:88751161-88751183 CTTTTTCAGAATCTATTTTATGG - Intronic
1011698467 6:89933990-89934012 TTTTTTAATAAACTTTTTTTTGG - Intronic
1011899905 6:92279674-92279696 CAATTACATAAACTCATTTTAGG + Intergenic
1012201624 6:96413275-96413297 TATTTTCATAAACTATTTCTTGG - Intergenic
1012432786 6:99183743-99183765 CAATATCATCAAATATTTTTTGG - Intergenic
1012506815 6:99956235-99956257 CTAATTCAAATAATATTTTTTGG + Intronic
1012578528 6:100833611-100833633 TTAATTAATAAACTAATTTTTGG - Intronic
1013309204 6:108878080-108878102 CTACTACGTAAACTTTTTTTTGG - Intronic
1014052704 6:116974447-116974469 CTATTTCTTAAAGCAGTTTTAGG + Intergenic
1014286155 6:119501397-119501419 TTATTTCATGAACTATATATTGG - Intergenic
1014662095 6:124185636-124185658 CTATTTCATGAAGTATTTGAAGG - Intronic
1015297450 6:131613778-131613800 CTTAGTCATAAACTTTTTTTAGG + Intronic
1015433449 6:133157265-133157287 CTATTTTTTAAACTTTTTGTAGG - Intergenic
1015454167 6:133406227-133406249 TTATTTCGTAAACTTCTTTTGGG - Intronic
1015504836 6:133973139-133973161 CTATTTCCTAATCTACTATTTGG + Intronic
1015606828 6:134965906-134965928 CAATTAAATAAACTAGTTTTAGG + Intronic
1016613908 6:146025421-146025443 CTATTTAATACACTATTTAGTGG - Intergenic
1017194215 6:151682883-151682905 CTATTTCATAAAATTTTTGTAGG - Intronic
1017694655 6:157002558-157002580 CTATTTTATGATCTATTTTATGG + Intronic
1018091687 6:160351068-160351090 ATATTTCAAAAACTTTTTTGGGG - Intronic
1018256243 6:161922564-161922586 GAATTTCATAAATTATTTGTGGG + Intronic
1018407298 6:163500734-163500756 CTAATTCATAAAGTATTTGTTGG - Intronic
1018438619 6:163787708-163787730 CTTTTTCATATAATATTTCTTGG - Intergenic
1018571592 6:165216895-165216917 ATTTTTCATAATCTATATTTTGG - Intergenic
1018766430 6:166936825-166936847 CCACTTAATAAACTATTTGTTGG + Intronic
1019114128 6:169743393-169743415 CTATTTCAGTAACAATTTTGAGG + Intronic
1019867302 7:3724263-3724285 CTATTTCATACAGCAATTTTTGG - Intronic
1020433516 7:8137500-8137522 GTCTTTCACAAATTATTTTTTGG - Intronic
1020683447 7:11265042-11265064 CTTTTCCATAAACTATTTTATGG - Intergenic
1020846144 7:13286144-13286166 TTATGTCATCAACTGTTTTTGGG - Intergenic
1020892074 7:13890332-13890354 CTATTTTAAAAACAATTTTTTGG + Intergenic
1021139757 7:17009559-17009581 TTATTTCATAATCTGTATTTTGG + Intergenic
1021272454 7:18607066-18607088 CTTTTTCATAAAAAATTTTTAGG - Intronic
1022001498 7:26230421-26230443 CTAACTCATAAACTTCTTTTGGG - Intergenic
1022020386 7:26395055-26395077 TTTTTTCAAACACTATTTTTTGG + Intergenic
1022284148 7:28939036-28939058 CTGATTCAGAAAATATTTTTAGG + Intergenic
1022977436 7:35572086-35572108 CTGTTTTCTAAACTATTCTTAGG - Intergenic
1023098976 7:36693696-36693718 CAATTTGATAAACTATTATTAGG + Intronic
1023601873 7:41888444-41888466 CTATTTTCTAAACTACTTTGGGG + Intergenic
1023645602 7:42310690-42310712 CTATTTCATAGATAATTTGTGGG - Intergenic
1023673404 7:42603978-42604000 TTAAATCATAAACTCTTTTTGGG - Intergenic
1024952697 7:54881168-54881190 ATATTTCTTAATATATTTTTGGG + Intergenic
1025617373 7:63133182-63133204 TTATTTCTTATACTAATTTTGGG - Intergenic
1025984767 7:66440137-66440159 CTTTTTAAAAAATTATTTTTAGG - Intergenic
1027207978 7:76118728-76118750 CTTTTTAAAAAATTATTTTTAGG - Intergenic
1028287885 7:89026535-89026557 TTATTTCATAACCAAATTTTTGG - Intronic
1028640092 7:93032167-93032189 CTTTTTTAAAAACTTTTTTTTGG - Intergenic
1028908617 7:96182861-96182883 TTGCTTCATAAACTACTTTTTGG - Intronic
1029522140 7:101069739-101069761 CTAATTTTTAAACTATTTGTAGG + Intergenic
1030149537 7:106389410-106389432 CTATTTAAGAAAATATATTTAGG - Intergenic
1030724649 7:112912233-112912255 CTATTTCCTGAACTATTTGAAGG - Intronic
1030745616 7:113162051-113162073 TTATTTCATAAGCTGTTTTGAGG + Intergenic
1030860521 7:114619560-114619582 CTATTTCATAAAATGTTGCTAGG + Intronic
1030889855 7:114986197-114986219 CTTTTTTTAAAACTATTTTTTGG + Intronic
1030986615 7:116248931-116248953 ATAGTTCATAAAATACTTTTAGG - Intronic
1031236123 7:119180038-119180060 ATATTTCATATACTTTTTTGAGG + Intergenic
1031271816 7:119659743-119659765 CTAATACATAAAATATTTTCAGG + Intergenic
1031582752 7:123497548-123497570 CTATATCATAAACTTTTTGAGGG - Intronic
1031744660 7:125478928-125478950 TTAATACATAAACTATTTATGGG - Intergenic
1031939484 7:127772674-127772696 ATGTTTCATAATTTATTTTTAGG - Intronic
1032846822 7:135758413-135758435 ATATCTCAGAAACTCTTTTTAGG + Intergenic
1033705158 7:143879489-143879511 CTTTTTCAAAAACAATTTTATGG + Intronic
1033827610 7:145210730-145210752 ATATTTCCTAAAATATTTTAAGG - Intergenic
1033880984 7:145883546-145883568 CAATTTCAGAAACTACTATTAGG + Intergenic
1033981717 7:147173369-147173391 GTACTTCATAAACACTTTTTGGG - Intronic
1034094074 7:148390100-148390122 GTTTTTCATAAACCATGTTTTGG - Intronic
1034119404 7:148613458-148613480 CTATATAATAAACTATTACTGGG + Intronic
1034857624 7:154567133-154567155 CTCTTTCATAGACTTTTCTTAGG + Intronic
1035916755 8:3633066-3633088 CTATTTAATAAATTAGTGTTGGG - Intronic
1035958920 8:4115542-4115564 CTAATTCATAATTTATTATTTGG + Intronic
1037037587 8:14186750-14186772 TTATTTTATAAAGTACTTTTAGG - Intronic
1037166434 8:15835056-15835078 TCCTTTCATAAACAATTTTTTGG + Intergenic
1037197867 8:16214017-16214039 CAATTTCACTATCTATTTTTTGG + Intronic
1037495116 8:19432496-19432518 TTATTTCTTCAAATATTTTTAGG + Intronic
1038120338 8:24607163-24607185 CTTTTTAATGAACTATCTTTTGG - Intergenic
1038146636 8:24903485-24903507 CTATTTCATAATGTGGTTTTGGG - Intergenic
1038808692 8:30818196-30818218 CTATTTAAAAAAATTTTTTTAGG + Intergenic
1039312448 8:36332157-36332179 GTATTTCCAAAACTATTTCTTGG - Intergenic
1039496399 8:37983898-37983920 TTACTTTATAAACTTTTTTTTGG - Intergenic
1040378762 8:46851890-46851912 ATATTGCATAAACTCTTTCTTGG + Intergenic
1041138914 8:54792898-54792920 CTTTTCCAAAAACTAATTTTTGG - Intergenic
1041671756 8:60498826-60498848 TTATTTGGTTAACTATTTTTTGG - Intergenic
1041748279 8:61232555-61232577 CTATTTAGTAAAATATTTTATGG - Intronic
1041858381 8:62483411-62483433 GCATTTCATAAAGTATTATTCGG + Intronic
1041920310 8:63175611-63175633 ATATTTCATAACCTAGTTTCTGG - Intronic
1041992400 8:64009318-64009340 TTATTTTATAAACTGTGTTTTGG + Intergenic
1043169425 8:76946587-76946609 CTTTTTCATTAATTATTTCTAGG - Intergenic
1043220661 8:77658853-77658875 TTATTTCTTAAACAATTTCTAGG - Intergenic
1043764719 8:84115996-84116018 CTATTTCATAGAAGATATTTGGG - Intergenic
1044051680 8:87514015-87514037 CTCTTCCATCAACTATTTTGTGG - Intronic
1044243020 8:89908845-89908867 CTAATTTAAAAAATATTTTTTGG - Intronic
1044628760 8:94259547-94259569 CTATTTCCAAAACTGTTTTGAGG - Intronic
1044770381 8:95624841-95624863 CTATTTTCCAAACTACTTTTTGG + Intergenic
1045334863 8:101191504-101191526 CTTTTTAATAAACTGTTTTTTGG - Intronic
1045714937 8:105031344-105031366 CCTTTGCATATACTATTTTTGGG - Intronic
1046132133 8:109978635-109978657 CTATGTCATTAAACATTTTTAGG + Intergenic
1046168810 8:110477519-110477541 CTATTTTTTAATTTATTTTTTGG + Intergenic
1046303045 8:112323425-112323447 CTATTTCAAATAACATTTTTAGG - Intronic
1047048277 8:121079613-121079635 CTAAATTATAAAATATTTTTTGG - Intergenic
1047378931 8:124337245-124337267 TTATTTCCTCATCTATTTTTTGG - Intronic
1047458182 8:125035793-125035815 CTATTTCATAAGCTTTTTTAGGG - Intronic
1047796757 8:128264971-128264993 TTATTTTATAAACTAAGTTTTGG - Intergenic
1048014420 8:130484723-130484745 CTATTTAATAAAATATTTGCTGG + Intergenic
1048098499 8:131321012-131321034 ATAATTCCTAAACAATTTTTTGG - Intergenic
1048391603 8:133971087-133971109 CTATTTCAGGAATTCTTTTTTGG - Intergenic
1048411011 8:134172673-134172695 TAATTTCATATACCATTTTTTGG + Intergenic
1048565359 8:135590555-135590577 TTATTTCAAAAACCATCTTTAGG - Intronic
1048645979 8:136420237-136420259 CTATTTAATAGACTAATTATTGG + Intergenic
1049131402 8:140846972-140846994 TTATTTCTTTAATTATTTTTTGG - Intronic
1050443388 9:5689481-5689503 ATATTTCAAAAACAATCTTTTGG - Intronic
1050896916 9:10894968-10894990 CTTTTGCATAAAATATTTTAGGG - Intergenic
1051075824 9:13234460-13234482 TTATTTCATAAAGCATTTTTTGG + Intronic
1051283759 9:15472876-15472898 GTAATTCAAAGACTATTTTTAGG - Intronic
1051407182 9:16750298-16750320 TAATTTCAGAAAATATTTTTAGG - Intronic
1051792199 9:20818207-20818229 CTATTTTAAAACCTTTTTTTTGG + Intronic
1051916287 9:22211856-22211878 CATATTCATAAGCTATTTTTGGG + Intergenic
1052013146 9:23434608-23434630 CTATTTCATAACCTTTGTTCTGG - Intergenic
1052043005 9:23761817-23761839 TTAAATCATAAACTATTTTGGGG - Intronic
1052182264 9:25544201-25544223 CTATTTATTAAACAATTTCTAGG - Intergenic
1052293060 9:26866221-26866243 CTATTTACTATACCATTTTTTGG - Intronic
1052961410 9:34300700-34300722 CTATTTCATACACAGTTTCTAGG + Intronic
1053389210 9:37721838-37721860 GCATTTCATATACAATTTTTAGG - Intronic
1053573237 9:39331520-39331542 CTGTTTCAAAAATTATTTATAGG - Intergenic
1053688831 9:40569475-40569497 CTATTTGCTAAAATTTTTTTAGG - Intergenic
1054094808 9:60890226-60890248 CTGTTTCAAAAATTATTTATAGG - Intergenic
1054116274 9:61166130-61166152 CTGTTTCAAAAATTATTTATAGG - Intergenic
1054123907 9:61287491-61287513 CTGTTTCAAAAATTATTTATAGG + Intergenic
1054275205 9:63061599-63061621 CTATTTGCTAAAATTTTTTTAGG + Intergenic
1054399625 9:64703341-64703363 CTATTTGCTAAAATTTTTTTAGG - Intergenic
1054433208 9:65187602-65187624 CTATTTGCTAAAATTTTTTTAGG - Intergenic
1054497175 9:65834067-65834089 CTATTTGCTAAAATTTTTTTAGG + Intergenic
1054591485 9:67016414-67016436 CTGTTTCAAAAATTATTTATAGG + Intergenic
1056074185 9:83021459-83021481 TTTTTTTATAAAATATTTTTGGG - Intronic
1056520437 9:87396109-87396131 CTATTTCATACACTAGCTTCAGG - Intergenic
1056829016 9:89899277-89899299 CTATTTCTTAAAGTGTATTTTGG - Intergenic
1058125315 9:101186769-101186791 ATATTTCATAACTTATTTTCTGG + Intronic
1058202056 9:102055884-102055906 CTATTTTTTAATCTATTTTCAGG + Intergenic
1058411643 9:104739769-104739791 CTATTTAATAAACTGTTCTTTGG + Intergenic
1058539054 9:105993045-105993067 CTATTTTTTAAAGTAGTTTTAGG - Intergenic
1059131900 9:111761114-111761136 CTATTTCATAAATGATATTGGGG + Intronic
1059876115 9:118636938-118636960 CTATTTTATAAACGATTTTATGG + Intergenic
1060679067 9:125545236-125545258 CTTTTTAAAAAACTATATTTAGG + Intronic
1061103042 9:128507194-128507216 CTATTTTTTAAAATATTATTAGG + Intronic
1062313391 9:135952242-135952264 GTAGTGCATAAGCTATTTTTGGG - Intronic
1185945868 X:4375535-4375557 ATATTTTAAAAATTATTTTTGGG - Intergenic
1186256048 X:7721199-7721221 CAATTTGATAAACAAATTTTTGG + Intergenic
1186655429 X:11606673-11606695 CCATTTCTTAAATTACTTTTGGG + Intronic
1188081756 X:25851712-25851734 CTATTTAATTAATTATGTTTAGG - Intergenic
1188374322 X:29409151-29409173 CAATTTCATCAATTATTGTTAGG - Intronic
1188459015 X:30401394-30401416 GTTTTTCACAAATTATTTTTAGG - Intergenic
1188560049 X:31457356-31457378 TTATTCCAAAAACTATTATTGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189521892 X:41778048-41778070 CTATACCATTAAATATTTTTTGG - Intronic
1190964150 X:55281505-55281527 TTATTTTAAAAAATATTTTTGGG + Intronic
1192677708 X:73215754-73215776 CTATTTGATAATGTATTTATAGG + Intergenic
1193335776 X:80287126-80287148 CTTTTTAAAAAACTATATTTGGG - Intergenic
1193373865 X:80733789-80733811 CTATTAAATTAACTATTTTAAGG - Intronic
1193467080 X:81862714-81862736 GAATTTTATAAAATATTTTTAGG - Intergenic
1193561258 X:83019508-83019530 CTATTTCATAGACCATATATTGG + Intergenic
1193654780 X:84186785-84186807 CAATTTCACCAACTATTTTTAGG + Intronic
1194256134 X:91636741-91636763 CTATTTCATGAACATTTATTTGG - Intergenic
1194413951 X:93587795-93587817 CTCTTTTATAGACAATTTTTTGG - Intergenic
1194431820 X:93817137-93817159 GTATTCCATACTCTATTTTTTGG - Intergenic
1194639016 X:96380156-96380178 TTTTTTCACAAACTATTTTTTGG - Intergenic
1195016198 X:100783943-100783965 CTTTTCCATACTCTATTTTTTGG - Intergenic
1195312622 X:103647062-103647084 TTATTTCTTATACTAATTTTGGG - Intergenic
1195636352 X:107120151-107120173 CTATTGCACTAACTATATTTTGG - Intergenic
1196214872 X:113038739-113038761 ATATTCCATAAACTATTGTCAGG + Intergenic
1196326337 X:114408382-114408404 CTACTTCGGAAACTATTATTAGG + Intergenic
1196329197 X:114449248-114449270 CTAGTGCAAACACTATTTTTGGG - Intergenic
1196332065 X:114483614-114483636 CTTTTTCATGAACAATTTTTTGG - Intergenic
1196461578 X:115937451-115937473 CTATTACATATAGCATTTTTAGG - Intergenic
1197165260 X:123370112-123370134 TTTGTTCATAAATTATTTTTAGG - Intronic
1197351047 X:125383894-125383916 CTATTTAATAAAATATCATTTGG + Intergenic
1197394628 X:125911369-125911391 CTATTTCAGATAATATTGTTAGG - Intergenic
1197812479 X:130459147-130459169 CTTTTTCATCAACTGTTTTCTGG - Intergenic
1198021086 X:132658547-132658569 CTAAATCCTAAAGTATTTTTTGG - Intronic
1198678466 X:139156081-139156103 CAATTTCAGAGACTCTTTTTAGG + Intronic
1198897029 X:141466779-141466801 CTATTTCAGAACCTACTTGTGGG - Intergenic
1199259988 X:145760962-145760984 CTCTTTTATAAAACATTTTTCGG + Intergenic
1199419163 X:147623227-147623249 CTATTTCTTATACTTTGTTTAGG - Intergenic
1199702702 X:150395862-150395884 CTTTTTAATAAACTAGCTTTTGG + Intronic
1200343949 X:155429386-155429408 CTATTTTTTAAACCATTTTAAGG - Intergenic
1200574864 Y:4876028-4876050 CTATTTCATGAACATTTATTTGG - Intergenic
1201637572 Y:16141936-16141958 CTATATTAGAAACTATTTTCTGG - Intergenic
1201686846 Y:16714362-16714384 CTATGTCCTAAAGTATTATTTGG + Intergenic
1202272756 Y:23086410-23086432 CTAATTCATAAACAAATTTTGGG - Intergenic
1202293270 Y:23334272-23334294 CTAATTCATAAACAAATTTTGGG + Intergenic
1202425753 Y:24720154-24720176 CTAATTCATAAACAAATTTTGGG - Intergenic
1202445036 Y:24949931-24949953 CTAATTCATAAACAAATTTTGGG + Intergenic