ID: 947203368

View in Genome Browser
Species Human (GRCh38)
Location 2:227637097-227637119
Sequence TGGGATCACCTGACGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947203361_947203368 -6 Left 947203361 2:227637080-227637102 CCCAACACTTTGGGGGGTGGGAT No data
Right 947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG No data
947203354_947203368 2 Left 947203354 2:227637072-227637094 CCCATAATCCCAACACTTTGGGG 0: 41
1: 3066
2: 56869
3: 348486
4: 242836
Right 947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG No data
947203356_947203368 1 Left 947203356 2:227637073-227637095 CCATAATCCCAACACTTTGGGGG 0: 6
1: 514
2: 5020
3: 4839
4: 3941
Right 947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG No data
947203362_947203368 -7 Left 947203362 2:227637081-227637103 CCAACACTTTGGGGGGTGGGATC No data
Right 947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947203368 Original CRISPR TGGGATCACCTGACGGGGGT GGG Intergenic
No off target data available for this crispr