ID: 947205903

View in Genome Browser
Species Human (GRCh38)
Location 2:227660998-227661020
Sequence GACCTACAGTCATACAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947205900_947205903 12 Left 947205900 2:227660963-227660985 CCAAATTTCACAGAAGTGTTTCT No data
Right 947205903 2:227660998-227661020 GACCTACAGTCATACAGGGAAGG No data
947205899_947205903 19 Left 947205899 2:227660956-227660978 CCACTCTCCAAATTTCACAGAAG No data
Right 947205903 2:227660998-227661020 GACCTACAGTCATACAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947205903 Original CRISPR GACCTACAGTCATACAGGGA AGG Intergenic
No off target data available for this crispr