ID: 947208877

View in Genome Browser
Species Human (GRCh38)
Location 2:227687450-227687472
Sequence CTGGATTCTCACTTGGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947208874_947208877 -5 Left 947208874 2:227687432-227687454 CCTCTGGGTGAGACACATCTGGA 0: 1
1: 0
2: 1
3: 14
4: 168
Right 947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG 0: 1
1: 0
2: 2
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947208877 Original CRISPR CTGGATTCTCACTTGGAGCA GGG Exonic
901031102 1:6307392-6307414 CTGCATTCCCACTTAGCGCAGGG - Intronic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
905902734 1:41592521-41592543 ATGGATGCTCACTTTGACCAAGG - Intronic
912352731 1:109029577-109029599 CTTGATTCTCACTTGAACCTGGG + Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915464709 1:156090035-156090057 CTGGATGCTGTCTTGGGGCAGGG + Intronic
915647580 1:157284698-157284720 CTGTATTCTCACATGGTGGAAGG + Intergenic
916953762 1:169810059-169810081 CTGCATCCTCACTTAGTGCAAGG + Intronic
917304165 1:173609734-173609756 ATGGAATGACACTTGGAGCAAGG - Exonic
917975919 1:180237521-180237543 ATGGATTCTCCCTTGGAAAATGG + Intronic
922222343 1:223618331-223618353 CTGGGTCCTCACCTGGTGCAAGG - Intronic
1062932486 10:1362575-1362597 CGCGATTCTCCCTTGGACCAGGG + Intronic
1064083614 10:12328316-12328338 CAGGAGAATCACTTGGAGCAGGG - Intergenic
1066111055 10:32197585-32197607 CTGGAATCTCTCTGGGAGGAGGG + Intergenic
1069637164 10:69931921-69931943 CTGTATTCTCATCTGGAGCTAGG + Intronic
1073023097 10:100463246-100463268 CTGGACTCTTACCTGGAGCTGGG + Intronic
1073032388 10:100537023-100537045 TTGGCTTCTCACTTTGAACAAGG - Intronic
1075867262 10:125735288-125735310 CTGGTTTCTCACTTGGCATAGGG + Intronic
1078056659 11:8014795-8014817 CTGTATCCTCACTTGGTGGAAGG + Intergenic
1080381931 11:31780907-31780929 CTGGATTCTGACATGAAGAATGG - Intronic
1081441739 11:43088367-43088389 CTGAATTTTCTCTTGGAGAATGG + Intergenic
1081621530 11:44621770-44621792 ATGCTTTCTCACTGGGAGCAAGG + Intergenic
1082766714 11:57174593-57174615 CTGCATTCTCACCTGGAGCTTGG + Intergenic
1084465278 11:69319723-69319745 CAGCAGTCACACTTGGAGCAAGG - Intronic
1084489846 11:69472255-69472277 CTGCATTCTCACTTGGCACAGGG - Intergenic
1087066968 11:94036363-94036385 TAGGATTCTGACTTGGAGAAGGG + Intronic
1087097158 11:94330209-94330231 CTGCATTCTCACATGGTGAAAGG + Intergenic
1087429643 11:98036412-98036434 CTGCATTCTCACATGGAGGAAGG - Intergenic
1090341605 11:126026753-126026775 TTGAATTCTCACTTGGTTCAAGG + Intronic
1092931676 12:13321391-13321413 CTGGACTCTCTCTTGGAACTTGG + Intergenic
1093794110 12:23290809-23290831 CTGGATTCTTATTTGTGGCATGG + Intergenic
1095286292 12:40414810-40414832 CTGGTTTGAAACTTGGAGCAGGG + Intronic
1096320702 12:50610446-50610468 CTGAAGTTTCACTTGGAGGAGGG - Intronic
1096523268 12:52195939-52195961 CTGGATATTCCCTTTGAGCAGGG + Intergenic
1099173946 12:79398930-79398952 CTGGACAGTGACTTGGAGCAGGG - Intronic
1101728901 12:107410505-107410527 CGGGATTCTGACTTGGTGAAGGG + Intronic
1102113392 12:110382350-110382372 CTGTATTCTCATTTGGAAAATGG - Intronic
1108415659 13:50195998-50196020 CTGCATTCTCACATGGTGGAAGG + Intronic
1109431213 13:62237773-62237795 CTGGAGTATCACTTGAAGCCAGG - Intergenic
1111113968 13:83751753-83751775 CTGAATTGTCACCTGGAGGAAGG - Intergenic
1112719766 13:102230149-102230171 CTGTGTTCTCACATGGTGCAAGG - Intronic
1114171474 14:20277135-20277157 CTGCATTCTCACTTGGCAGAAGG + Intronic
1115104105 14:29739061-29739083 CTGGAGGATCACTTGAAGCAAGG - Intronic
1115599276 14:34940041-34940063 CTTCATTCTCACTCGGAACATGG + Intergenic
1115951402 14:38726411-38726433 CTGCAGTCTCATTTGGAGAATGG + Intergenic
1115963505 14:38862680-38862702 CTGGATTCTTCCTTGGTGCCTGG - Intergenic
1116595914 14:46844771-46844793 CTGGTCTCTCACTTGAAACATGG - Intronic
1117372423 14:55090682-55090704 GTGGATTCTTAATTGGAGGAGGG + Intergenic
1117568555 14:57021999-57022021 CTGGAATTTAACCTGGAGCAAGG + Intergenic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1119944534 14:78678752-78678774 CTGGATTCTCAGTAGAAACAAGG - Intronic
1120148697 14:81007673-81007695 CTGTATTCTCACTTACAGAATGG + Intronic
1123670748 15:22654410-22654432 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1123986400 15:25650211-25650233 CTGTATTCTCACATGGGGAAAGG + Intergenic
1124526722 15:30460837-30460859 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1124771931 15:32546846-32546868 CTGCATCCTCACTTGGTGAAAGG + Intergenic
1124952067 15:34332688-34332710 CTGGAGAATCACTTGGACCAGGG + Intronic
1125734956 15:41918464-41918486 CTGTATTTTCTCTTGGAGGAGGG + Intronic
1125931718 15:43604828-43604850 CTGGAGTCTCCTTTGGAGCCTGG + Exonic
1125944822 15:43704308-43704330 CTGGAGTCTCCTTTGGAGCCTGG + Intergenic
1127920059 15:63487440-63487462 ATGGACTCTCACTGGGAGCCCGG + Intergenic
1128781649 15:70362460-70362482 CTGGAATCTGACCTGGAGCCTGG - Intergenic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129181934 15:73883150-73883172 CTGGATGCTCCCTTGGGGCTGGG - Intronic
1130685544 15:86033893-86033915 CTGCATTCTCACATGGTGGAAGG + Intergenic
1131774373 15:95778418-95778440 CTGTATCCTCACTTGGAGGAAGG + Intergenic
1132129363 15:99261506-99261528 CTGTATTCTCACATGGTGGAAGG + Intronic
1132575970 16:664323-664345 CTGGCTTCTCACCCTGAGCATGG + Intronic
1132985312 16:2763391-2763413 CTGGATTCCACATTGGAGCAGGG - Exonic
1134754136 16:16651326-16651348 TTGGCTTCTCATTTGGTGCAAGG - Intergenic
1134782737 16:16913368-16913390 CTGCATCCTCACTTGGTGTAAGG - Intergenic
1138253985 16:55536171-55536193 CTGGAGTAGCACTTTGAGCAAGG - Intronic
1138745147 16:59354621-59354643 CAGGAATATCACTTGGAGCCAGG + Intergenic
1138802738 16:60054340-60054362 CTGCATTCTCACATGGTGAAAGG - Intergenic
1139138366 16:64232719-64232741 AGGGATTCTGACTTGTAGCATGG - Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141702379 16:85648443-85648465 CTGGGGCCTCACTTGGAGCAGGG + Intronic
1145016246 17:19400219-19400241 CTCGATTCTGACTTGGAGCAGGG + Intergenic
1145104458 17:20103681-20103703 CTGCAGTCTCCCTAGGAGCATGG + Intronic
1149701726 17:58660846-58660868 CTTCATTCTCACTCGGAACATGG - Intronic
1150787994 17:68178142-68178164 GTGGATTCTAACTTGCAGCCAGG - Intergenic
1152355969 17:79807479-79807501 CTGGATTGTCACAGGGGGCAGGG + Intergenic
1154143146 18:11843430-11843452 CAGGATAATCACTTGAAGCAGGG + Intronic
1159523236 18:69553732-69553754 CTGGATTTTCAATTGGAGTCTGG - Intronic
1159909623 18:74133336-74133358 CTGGAATCAGATTTGGAGCATGG - Intronic
1160462486 18:79049465-79049487 CTGGAGGCTCACTTGAAGCCAGG - Intergenic
1160870256 19:1274683-1274705 CTCGAGTCTCTCCTGGAGCACGG + Intronic
1162043272 19:7983224-7983246 CTGGGTTCTCACTTTGTCCAGGG - Intronic
1165305276 19:34999754-34999776 CTGGATTCTGACTTGGTACTTGG + Intronic
1165716545 19:38049543-38049565 GCGGATGCTCACTTGAAGCATGG - Intronic
1167449659 19:49559780-49559802 CTGTATTCTCACATGGGACATGG - Intronic
926014845 2:9441802-9441824 CTGTTTTCTCTCTTAGAGCATGG + Exonic
926214776 2:10898174-10898196 CTGGATGCTGATTTGGAGGAAGG + Intergenic
927640101 2:24840709-24840731 CTGCAAGCCCACTTGGAGCAGGG + Intronic
928230697 2:29496371-29496393 CTAGATTCACACTTGGTTCAGGG + Intronic
928467672 2:31537893-31537915 GTGTATTCTCACGTGGAGGAAGG - Intronic
928807563 2:35178879-35178901 CTGGATTCTGAGATGGAGGAAGG - Intergenic
928844130 2:35648713-35648735 CTGTATTCTCACAGGGAGGAAGG + Intergenic
929430219 2:41880056-41880078 CTGGACTATCATTTGGACCATGG + Intergenic
930942355 2:57028123-57028145 CTGGATTCTCCCTTGGTGCTGGG - Intergenic
931118387 2:59189420-59189442 CTTGATTCACAATTGGAGCCTGG - Intergenic
933850530 2:86362940-86362962 CTGCATTCTCACATGGTGGAAGG - Intergenic
936097621 2:109544540-109544562 CAGGGTTCTCAAGTGGAGCAGGG + Intronic
943643784 2:190386714-190386736 CTGGAGTCTAACTGGGAGCCAGG - Intergenic
944910138 2:204302836-204302858 CTGAAGTCTTACTTGGAGGAAGG - Intergenic
945447886 2:209959724-209959746 CTGTGTTCACACTTGGGGCAGGG - Intronic
945469404 2:210210195-210210217 CTGGATTCTCAATGGAAGCAAGG - Exonic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
948326242 2:237123990-237124012 CTGTATTCTCACTTGGCAGATGG - Intergenic
948461838 2:238133422-238133444 CTGGTTTCTCATTTGCAGCTTGG + Intergenic
948484503 2:238271911-238271933 CTGGAATCTCTCTGGGAGGAGGG - Intronic
948641327 2:239377661-239377683 CTGGCTTCTCACAAGGGGCAGGG + Intronic
1168736443 20:142779-142801 CTGGCTTCTCACTGGGAGCAGGG + Intronic
1169057038 20:2631680-2631702 CTGGATTCTCTCTTTGACTATGG + Intronic
1169231308 20:3890250-3890272 CTGGATTCTCACGAGAAGAAGGG - Intronic
1170601269 20:17843348-17843370 CTGGATTCTGTCTGGGGGCAGGG - Intergenic
1171116554 20:22529798-22529820 CTGGCTTCTCAACTGGAGCTGGG + Intergenic
1172003041 20:31795558-31795580 CCGGGTGATCACTTGGAGCAGGG - Intronic
1173207073 20:41003474-41003496 CAGGTTTCTCATTTGAAGCATGG - Intergenic
1174126494 20:48310681-48310703 CTGGATACTCACTTGCTCCAGGG + Intergenic
1174307505 20:49624590-49624612 CTGTTTTCTCATTTGGAGAAGGG - Intergenic
1175788082 20:61724254-61724276 CTGGATGCTGCCTTGAAGCAGGG - Intronic
1175972965 20:62696428-62696450 CTGGTCTCTCACTTGGCACATGG - Intergenic
1177535302 21:22419542-22419564 CTGTATTCTCACATGGTGGAAGG - Intergenic
1177717830 21:24863067-24863089 CTGTAACCTCACTTGGAGAAAGG - Intergenic
1179553308 21:42156901-42156923 CTGCATTCTCACCTGGAAGAAGG - Intergenic
1182637343 22:31738722-31738744 CTGGAATCACACTTGGCTCAGGG + Exonic
1183069224 22:35384618-35384640 CTGGATTCTCTCATGGATCTTGG - Intronic
1183374902 22:37457465-37457487 CTGGCTTCTCACCTGGCCCAGGG - Intergenic
1183545643 22:38453807-38453829 CTCCATTCTCACTGGGAGGAGGG - Intronic
1184891259 22:47380889-47380911 CAGGATGCTGACCTGGAGCAAGG - Intergenic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
954445227 3:50542751-50542773 CAGGATGCTGACCTGGAGCAAGG - Intergenic
957702013 3:83726921-83726943 CTGGATTATAACTTGCAGGATGG + Intergenic
961426488 3:126852303-126852325 CTGGCTTCTCATCTGTAGCAGGG + Intronic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
963480549 3:145868028-145868050 CTGGACTCTGACTAGTAGCAAGG - Intergenic
963534485 3:146511113-146511135 CTGCATTCTCACATGGCGGAAGG - Intergenic
965953890 3:174344646-174344668 CTGAGGTCTCAGTTGGAGCATGG + Intergenic
967844568 3:194033538-194033560 CTGGATTCTAACTTGCAGCCAGG - Intergenic
969676222 4:8615809-8615831 CTCGATTCTTACTTGGAGGAAGG - Intronic
971694398 4:29880088-29880110 CTGGATGCGTACTTGGACCATGG + Intergenic
972927657 4:44031367-44031389 CTGCATTCTCATCTGGAGCTTGG - Intergenic
975796339 4:78010569-78010591 CTGCATCCTCACTTGAAGGAAGG - Intergenic
977206950 4:94173822-94173844 CTCCATTCTCACATGGAGAAGGG - Intergenic
977297344 4:95225447-95225469 ATGGATTGTCAAATGGAGCAAGG + Intronic
978107981 4:104927890-104927912 CTGGATGATCACTTGAAGCCAGG + Intergenic
982177292 4:152718166-152718188 CTGCATCCTCACTTGGTGGAAGG + Intronic
983557842 4:169074242-169074264 CTGCATTCTCACATGGTGGAAGG + Intergenic
984905456 4:184621811-184621833 CTGTCTTCTCACTTGGTTCATGG + Intergenic
986028948 5:3877452-3877474 CTGTCTTCTCACCTGGAGCAAGG - Intergenic
986225958 5:5812964-5812986 CTGTATTCTCACATGGTGAAGGG - Intergenic
991953708 5:71971725-71971747 CTGTATTCTCACATGGGGGAAGG + Intergenic
993582289 5:89677635-89677657 CTGGAGTCTCACTAGAAGCCAGG - Intergenic
996236397 5:121135910-121135932 CTAGATTCTGAGATGGAGCAGGG - Intergenic
997127247 5:131239796-131239818 CTGGTTTCTCATTTGGGGAAGGG + Intergenic
999059688 5:148620091-148620113 CTGGATGTTCACCTGGGGCAAGG + Intronic
1002470339 5:179431244-179431266 ATGGATTCTTAATTGGTGCAGGG - Intergenic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1004767332 6:18745014-18745036 CTGCATTCTCATCTGGAGCTGGG - Intergenic
1005040498 6:21595828-21595850 CTGGATTTTAACTTCGAGCCCGG + Exonic
1008438096 6:51499573-51499595 CTGTGTTCTCACTTGGTGGAAGG + Intergenic
1010622206 6:78090427-78090449 CTGGAATCTCTCTGGGAGGATGG + Intergenic
1013615414 6:111838444-111838466 GTGAATTATCACTTGGACCAGGG - Intronic
1016017091 6:139197859-139197881 CTGGATTCTCACTTGGCAGAAGG + Intergenic
1017489079 6:154928461-154928483 CTGAATTCACACTTCCAGCATGG - Intronic
1017607680 6:156150875-156150897 CTGTATTCTCACATGGTGGAAGG + Intergenic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018967627 6:168500842-168500864 CTCGATTCTCACTGGGACCCTGG + Intronic
1021554287 7:21904019-21904041 CTGGGTTCTCACTGGGAACTAGG - Intronic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1025023926 7:55500466-55500488 CTGCATTCTCACCTGGAGCTTGG - Intronic
1025952767 7:66158470-66158492 CTGGATCCTCACATGGCACAAGG - Intergenic
1025955361 7:66178494-66178516 CTGGCTTCTAACTTGGGGGATGG + Intergenic
1028603666 7:92630822-92630844 CTGGAAGGTCATTTGGAGCAAGG + Intronic
1029276781 7:99409869-99409891 CTGGGTTCTCTCTGGCAGCAAGG + Intronic
1029381194 7:100215918-100215940 CTGGGTTCACACTTGGAACCCGG + Intronic
1030297556 7:107944166-107944188 CTGGATTCATGCTTGGGGCAAGG + Intronic
1030330980 7:108270247-108270269 CTGGATTCTGAGTTGGAACTGGG + Intronic
1033424687 7:141233460-141233482 GTGGACTATCACTTGGAGAAAGG - Intronic
1033947298 7:146736221-146736243 CTGGAGTTTCATATGGAGCAGGG + Intronic
1034495916 7:151422087-151422109 CTGGATTCTGGCTTGCACCAAGG - Intergenic
1036067307 8:5396200-5396222 CGGCATTCTCACATGGAGGAAGG + Intergenic
1037200189 8:16242656-16242678 CTGTTCTCTCACTTGGAGCTAGG + Intronic
1039099742 8:33928481-33928503 CTGCATTCTCACATGGTGGAAGG + Intergenic
1039222963 8:35355830-35355852 CTGTTTTCTCACTTGGTGGAAGG - Intronic
1040378229 8:46847212-46847234 CATGATTCTCACTGAGAGCAGGG - Intergenic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1042295811 8:67216336-67216358 CTGCATTCTCACGTGGTGGAAGG - Intronic
1045067898 8:98468241-98468263 CTGCATTCTCACTTGCCACATGG + Intronic
1049275483 8:141718119-141718141 CTGGATCCTCTCCTGGAGGAGGG - Intergenic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1050810975 9:9747418-9747440 GTGGATTCTGTCTTGTAGCATGG - Intronic
1052083411 9:24234771-24234793 CTGTATTCTCACATGGTGAAAGG + Intergenic
1052804625 9:33001760-33001782 CAGGATCCTCAGTTGGACCACGG - Intronic
1055326451 9:75135767-75135789 CTGGATTCTCATCTGGAGCTTGG + Intronic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG + Intronic
1059977419 9:119732178-119732200 ATGGATTCTCACCTAGAGCCTGG + Intergenic
1186690110 X:11966338-11966360 CTGCATTCTCACATGGAAGAAGG - Intergenic
1191997730 X:67114454-67114476 CAGATTTCTCACCTGGAGCAAGG + Intergenic
1192327873 X:70148808-70148830 CTTCATTCTCACTCGGAACATGG + Exonic
1193978408 X:88151650-88151672 CTGTGTTCTCACTTGGAAAAAGG + Intergenic
1195247933 X:103013327-103013349 CTGCATTCTCATTTGGAACTTGG + Intergenic
1196455960 X:115891807-115891829 CTGGATGCTGCCTTGGAGCTTGG + Intergenic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1198217175 X:134566282-134566304 CTGGCTACTCTCATGGAGCAGGG + Exonic
1198792769 X:140363485-140363507 CTGCATTCTCATCTGGAGCTTGG - Intergenic
1198986522 X:142460660-142460682 CTGTATTCTCACTTGGTGAAAGG + Intergenic
1200284826 X:154810615-154810637 CTGAATTCTCACATGGTGGAAGG + Intronic