ID: 947218239

View in Genome Browser
Species Human (GRCh38)
Location 2:227768394-227768416
Sequence TCTCCTTTTCAGGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947218229_947218239 21 Left 947218229 2:227768350-227768372 CCTTAGTTTATCGTAGGGCACGG No data
Right 947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG No data
947218232_947218239 -8 Left 947218232 2:227768379-227768401 CCTCCTTCCCCAGAGTCTCCTTT No data
Right 947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947218239 Original CRISPR TCTCCTTTTCAGGAGCTGCA GGG Intergenic
No off target data available for this crispr