ID: 947223650

View in Genome Browser
Species Human (GRCh38)
Location 2:227819510-227819532
Sequence CACAAGCACATGGCTAGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947223648_947223650 -3 Left 947223648 2:227819490-227819512 CCAAGCGTCAAGTATGCGGACAC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 947223650 2:227819510-227819532 CACAAGCACATGGCTAGATTAGG 0: 1
1: 0
2: 0
3: 11
4: 133
947223646_947223650 25 Left 947223646 2:227819462-227819484 CCAATTTATTAATCAACAACGAA 0: 1
1: 0
2: 0
3: 23
4: 203
Right 947223650 2:227819510-227819532 CACAAGCACATGGCTAGATTAGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947223650 Original CRISPR CACAAGCACATGGCTAGATT AGG Intergenic
901710109 1:11107272-11107294 CAGAAACACAAGGCTTGATTTGG - Exonic
902716194 1:18274490-18274512 CAAAAACAGATGGCCAGATTTGG - Intronic
908587470 1:65586675-65586697 AACAGGCAGATGGCTGGATTTGG + Intronic
908941632 1:69441978-69442000 AACAGGCAGAGGGCTAGATTTGG - Intergenic
910431783 1:87166624-87166646 CACCAGCAAATGGCAAGATTAGG + Intronic
912739080 1:112176860-112176882 CTGAAGCAGGTGGCTAGATTTGG + Intergenic
914396578 1:147275276-147275298 AATAAGCACAAGGCTAGAGTGGG - Intronic
1063498579 10:6532479-6532501 CTGAAGCACATGTCAAGATTGGG - Intronic
1063498586 10:6532528-6532550 CTGAAGCACATGTCAAGATTGGG - Intronic
1067981379 10:51089605-51089627 CATAAGCATATGACTAGATGAGG - Intronic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1068814270 10:61292069-61292091 TCTAAGCACATGGCTAGCTTTGG + Intergenic
1069561161 10:69430685-69430707 CACAAGTACATGACTACTTTTGG + Intergenic
1071376534 10:85011146-85011168 GACAAACACATGGCTAGCTCTGG + Intergenic
1071764813 10:88651536-88651558 CAAAATTACATGGCTGGATTTGG + Intergenic
1072110141 10:92311527-92311549 CACAGGCAAATGGATAAATTTGG - Intronic
1072221001 10:93327425-93327447 CACAAGCTCATGGCCAGCCTCGG + Intronic
1076804787 10:132849934-132849956 CGCCAGCACAGGGCTTGATTGGG + Intronic
1080114057 11:28602017-28602039 GACAAGCACTTGGCTGGATTTGG - Intergenic
1080291879 11:30680147-30680169 CATAGTCACATGGCTAAATTGGG - Intergenic
1080417361 11:32081250-32081272 CACTGGCACATGGCTTGCTTTGG + Intronic
1085175972 11:74488496-74488518 AACAAGGAAATGTCTAGATTAGG + Intergenic
1086589736 11:88499351-88499373 CACAAGCACCTCAATAGATTTGG - Intergenic
1087975274 11:104537790-104537812 CACAACCACATGACTTGCTTTGG + Intergenic
1088637808 11:111841025-111841047 AACAAGCACAATACTAGATTTGG + Intronic
1090972673 11:131656484-131656506 CCCAACCACATGGATAGACTTGG + Intronic
1091148371 11:133301249-133301271 CACAATCCCATGCCTAGAGTAGG + Intronic
1091182819 11:133622197-133622219 CACAGGGACATGACCAGATTTGG - Intergenic
1099198058 12:79642347-79642369 ATCAAGCACATGCCTACATTAGG + Intronic
1100380664 12:94058775-94058797 CACTAGCACATAGCTCCATTCGG + Intergenic
1102066496 12:109980479-109980501 AACAAGTAACTGGCTAGATTTGG + Intronic
1103806054 12:123574048-123574070 CCAAAGCACATGGCTTGAGTGGG - Intergenic
1104831045 12:131751630-131751652 CAGAAGCACATGCTTATATTCGG + Intronic
1105055768 12:133097807-133097829 CACACACACATGGTTAGATGTGG - Intronic
1106036328 13:26048537-26048559 CATAAGCACAGGGGTGGATTGGG + Intronic
1106576641 13:30981091-30981113 CAGAATCACATGGCTGGATTGGG - Intergenic
1107116812 13:36755937-36755959 CACAAGCAATGGGCTAGATGAGG - Intergenic
1107455339 13:40549752-40549774 CACAGCCACAAGGCTATATTTGG + Intergenic
1108743864 13:53369366-53369388 AACATGCAGAAGGCTAGATTTGG - Intergenic
1109479270 13:62928079-62928101 CAGAAGTACATGGTCAGATTGGG - Intergenic
1110114804 13:71799685-71799707 CAAAACCACATGGCCAGATTTGG - Intronic
1110690104 13:78422907-78422929 CACAAGCACATCTCTAGAGTGGG + Intergenic
1111365924 13:87244719-87244741 CACAAGCGCATGCCTATATGGGG + Intergenic
1111573943 13:90125885-90125907 CAAAAGCAAATGCCTAGTTTGGG + Intergenic
1115722590 14:36179232-36179254 CACATGCACATGTCTTGCTTTGG + Intergenic
1117236688 14:53785229-53785251 CACAATCACATGGCTCATTTAGG - Intergenic
1120750483 14:88192961-88192983 CACAAATACTTGGCTAGAGTCGG - Intronic
1121223307 14:92302640-92302662 CACATGCAGAGGGCTAAATTTGG + Intergenic
1126916074 15:53467678-53467700 CGCAAGCACACGGGTAGATGTGG - Intergenic
1139524895 16:67509185-67509207 CACTAGCAGTGGGCTAGATTTGG + Intergenic
1144524245 17:15976708-15976730 CACAAGCACAGGGCTTTCTTAGG + Exonic
1145986116 17:29047748-29047770 AACAAGCAGAAGGCCAGATTTGG + Intronic
1146667982 17:34717314-34717336 CACAAGCACTTGGCTTGCTCAGG + Intergenic
1152150477 17:78597077-78597099 AACAGGCAGAGGGCTAGATTTGG + Intergenic
1153342255 18:3987475-3987497 CAAAAGCAAATAGCTACATTGGG + Intronic
1155817833 18:30336822-30336844 CCCAAGTACATGGGTAGAATGGG - Intergenic
1158310067 18:56148659-56148681 CACATGAGCATGGCTAGTTTTGG - Intergenic
1159509364 18:69376742-69376764 TACATTCACATGACTAGATTGGG + Intergenic
1161017445 19:1990321-1990343 CACACTCACAGGGCCAGATTTGG - Intronic
929538382 2:42799964-42799986 CACAAGCATCTTGATAGATTAGG - Intergenic
932861078 2:75291789-75291811 CACAAGAGCATGGCTAGCTAGGG - Intergenic
934536344 2:95137346-95137368 CACAACCACATGGCCATTTTGGG - Intronic
934584424 2:95477797-95477819 CACAAGTAAATGGCTAAACTAGG + Intergenic
934595028 2:95598918-95598940 CACAAGTAAATGGCTAAACTAGG - Intronic
934787740 2:97026608-97026630 CACAAGTAAATGGCTAAACTAGG + Intergenic
935209837 2:100929724-100929746 CACCAGCAGATGGCTAGGTAAGG + Intronic
940663415 2:156575726-156575748 AGCAAGCAGATGGCTAGATTAGG + Intronic
940788552 2:158007499-158007521 CACAATGACATGGTTAGATGAGG - Intronic
942849231 2:180463605-180463627 CACAAGTACCTGGCTAGGTGAGG - Intergenic
945129657 2:206556771-206556793 CAAAAGCAAATGGCTTCATTTGG + Intronic
947138548 2:226999479-226999501 AAAAAGCACATGGCAAGATTCGG - Intergenic
947223650 2:227819510-227819532 CACAAGCACATGGCTAGATTAGG + Intergenic
1175771191 20:61625491-61625513 GACAAACACAGGGCTATATTAGG + Intronic
1181894759 22:26097382-26097404 CACAACAACATGGATAGAATTGG - Intergenic
1182872170 22:33657584-33657606 CACAAGCAGAGGGCCAGATCAGG + Intronic
1182973979 22:34605200-34605222 CACAGCCACATGGCTACAGTTGG - Intergenic
951098364 3:18657904-18657926 AACAAGCAAATGGGCAGATTGGG - Intergenic
955947186 3:64206615-64206637 CCCAAGTCCATGGCTAGATCAGG + Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
959825561 3:110791787-110791809 CATAGGCACATGGCTGGATTAGG + Intergenic
964655098 3:159057721-159057743 TAGAAGCTCATGGCCAGATTTGG + Intronic
964896787 3:161607253-161607275 CACAGGCATTGGGCTAGATTTGG - Intergenic
967759256 3:193205219-193205241 CAAAAGCTGATGGCCAGATTTGG + Intergenic
969218145 4:5739605-5739627 AAGAAGGACATGGCCAGATTTGG - Intronic
970108183 4:12608756-12608778 TACAAGCACCTGGCCAGATTTGG - Intergenic
972459711 4:39289931-39289953 CACAAGCCCATCCCTGGATTCGG - Exonic
975231301 4:71936985-71937007 CAAAATCACAAAGCTAGATTGGG - Intergenic
976087915 4:81425237-81425259 AACAAGCAGCTGGCTAGATCTGG + Intergenic
977805031 4:101287531-101287553 CACACTCACATGCCTAGAGTTGG - Intronic
979458687 4:120954825-120954847 CAAAATCACATAGCTAGACTTGG + Intergenic
984882258 4:184420367-184420389 CACAAGCAAATGGAGATATTTGG - Intronic
987222867 5:15808387-15808409 CGCAAGTCCATGGCTAGATATGG - Intronic
987641213 5:20614909-20614931 AACAAGCACTGGGCTGGATTTGG - Intergenic
988161337 5:27521357-27521379 CTCAATGACAAGGCTAGATTCGG + Intergenic
990802023 5:59615153-59615175 AAGAAGCGCATGGCTAGAATGGG - Intronic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
991666662 5:69006232-69006254 AACAGGCACATGGCTGGAGTGGG - Intergenic
992763262 5:79970634-79970656 CCCAAGCAAAGGGCTGGATTGGG + Intergenic
997779414 5:136641680-136641702 CTCAAGCAGATGGCTGGACTGGG - Intergenic
999121316 5:149211652-149211674 CACAACCAACTGGCCAGATTTGG - Intronic
999121350 5:149211927-149211949 CACAACCAAGTGGCCAGATTTGG + Intronic
999249686 5:150175273-150175295 CACTGGCACATGGCCAGACTGGG + Intronic
1001285619 5:170421319-170421341 CACAACCACATGGCGAAACTGGG - Intronic
1003421562 6:5963045-5963067 CACAAGGCCATGGCTAAATGTGG + Intergenic
1004184091 6:13407086-13407108 GACAAGCATAAGGCTATATTGGG + Intronic
1005064979 6:21809054-21809076 CACAAGGTCATGGCTGGGTTTGG - Intergenic
1005500178 6:26422633-26422655 CTCAGGCACAGCGCTAGATTGGG + Intergenic
1005748236 6:28859860-28859882 CACAACCAAATGGCTATCTTGGG - Intergenic
1006621307 6:35366481-35366503 CACAGGCAGAGGCCTAGATTAGG + Intronic
1006835145 6:36993918-36993940 CACAATAAGATGGCCAGATTTGG - Intergenic
1007547911 6:42708335-42708357 CCCACGCACATGGCTGGAGTGGG - Intronic
1009830574 6:68926679-68926701 GACAAGCACATCGATAGATGAGG - Intronic
1010336068 6:74684890-74684912 CAGAGGCCCATGGCTAGAGTGGG - Intergenic
1010654526 6:78496424-78496446 CACAATCACATGGCAAGAAGAGG + Intergenic
1016797555 6:148133907-148133929 CAGAATCACATTGCTAGATGTGG + Intergenic
1022959692 7:35414740-35414762 CACAAGCCCATGGCTGGAGGGGG - Intergenic
1024053954 7:45647550-45647572 CACAAGCACAGTGCTGGATGAGG - Intronic
1025922274 7:65924582-65924604 AACAAGCAGTGGGCTAGATTTGG + Intronic
1027007329 7:74706349-74706371 CACCAGCACGTGGCTTGATCAGG + Intronic
1027750872 7:82143959-82143981 CAGAATCACATGATTAGATTGGG - Intronic
1028544110 7:91978578-91978600 CACTATCACATGCCTGGATTTGG - Intronic
1031189684 7:118531779-118531801 AACAGGCAGAAGGCTAGATTTGG + Intergenic
1031875545 7:127136087-127136109 CACTAACACATGGCTACATATGG + Intronic
1034953841 7:155320662-155320684 CACAAGCAAAAGGATAAATTTGG - Intergenic
1036564486 8:9926713-9926735 CACAGGCACATGGTTACATAGGG - Intergenic
1037781615 8:21873061-21873083 CACATACACAAGACTAGATTTGG - Intergenic
1038297158 8:26304475-26304497 CAGAAGAACATGGTTAGATCTGG + Intronic
1041085437 8:54252156-54252178 CTCAGGCACATGCTTAGATTGGG + Intergenic
1041106723 8:54452186-54452208 CAAAAGCAAATGTCTATATTTGG - Intergenic
1044318217 8:90773874-90773896 CACAAGCACAGGGGTAGACAAGG + Intronic
1047115146 8:121833644-121833666 TACAAGCCTATGGCTGGATTTGG + Intergenic
1048961864 8:139586735-139586757 AACAAGCACAAGCCTAGATAAGG + Intergenic
1049854007 8:144850305-144850327 CAAAAGCACCTGGCTACATGGGG + Exonic
1051330276 9:16018147-16018169 CACAAACACATGGGTGGATATGG - Intronic
1052576932 9:30302919-30302941 TACAAGGACATGGATAGATCTGG + Intergenic
1056826074 9:89877202-89877224 CACAAGCACAGGGCAAGAGTGGG - Intergenic
1057033143 9:91793984-91794006 CATAGGCACATGGCTGGTTTTGG - Intronic
1057137865 9:92706721-92706743 CACAAGCACATGGCTGCCTCAGG - Intergenic
1188530419 X:31134141-31134163 CACAAGCACAGGGTTAGAGGAGG - Exonic
1192753292 X:74017830-74017852 GACAAGCATACTGCTAGATTTGG + Intergenic
1193115943 X:77775390-77775412 AACAATCACATGGCCAGGTTTGG + Intronic
1193214850 X:78851681-78851703 CACAAGCACATCCCTAGATCTGG + Intergenic
1194887053 X:99329315-99329337 CACAAAAACATGGCTGGACTGGG + Intergenic
1199534155 X:148883186-148883208 CACAAGCACATTTCTACATCTGG + Intronic
1201589518 Y:15599561-15599583 TACAGGCACCTGGCTAGTTTTGG - Intergenic