ID: 947224057

View in Genome Browser
Species Human (GRCh38)
Location 2:227823041-227823063
Sequence ATGGAGAAGTGGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947224051_947224057 9 Left 947224051 2:227823009-227823031 CCATAAAATCTGATTTCAGATGA No data
Right 947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947224057 Original CRISPR ATGGAGAAGTGGAAGATGGA AGG Intergenic
No off target data available for this crispr