ID: 947225435

View in Genome Browser
Species Human (GRCh38)
Location 2:227835427-227835449
Sequence CATACCATATAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947225435_947225438 -4 Left 947225435 2:227835427-227835449 CCTTCCTCTTTCTATATGGTATG No data
Right 947225438 2:227835446-227835468 TATGGATTTTTATTTATTCAAGG No data
947225435_947225439 20 Left 947225435 2:227835427-227835449 CCTTCCTCTTTCTATATGGTATG No data
Right 947225439 2:227835470-227835492 TTTGCAATCACTTACTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947225435 Original CRISPR CATACCATATAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr