ID: 947226584

View in Genome Browser
Species Human (GRCh38)
Location 2:227846332-227846354
Sequence GTGAGCTATGATCACACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947226584_947226586 -4 Left 947226584 2:227846332-227846354 CCAGCAGTGTGATCATAGCTCAC No data
Right 947226586 2:227846351-227846373 TCACTGAAGGCTCAAACTCTTGG No data
947226584_947226587 -3 Left 947226584 2:227846332-227846354 CCAGCAGTGTGATCATAGCTCAC No data
Right 947226587 2:227846352-227846374 CACTGAAGGCTCAAACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947226584 Original CRISPR GTGAGCTATGATCACACTGC TGG (reversed) Intergenic
No off target data available for this crispr