ID: 947227752

View in Genome Browser
Species Human (GRCh38)
Location 2:227856728-227856750
Sequence CTCACAGCTCAGAGAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947227747_947227752 -6 Left 947227747 2:227856711-227856733 CCCTGCTCCCATTCTTTCTCACA No data
Right 947227752 2:227856728-227856750 CTCACAGCTCAGAGAGGACTTGG No data
947227748_947227752 -7 Left 947227748 2:227856712-227856734 CCTGCTCCCATTCTTTCTCACAG No data
Right 947227752 2:227856728-227856750 CTCACAGCTCAGAGAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947227752 Original CRISPR CTCACAGCTCAGAGAGGACT TGG Intergenic
No off target data available for this crispr