ID: 947227752 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:227856728-227856750 |
| Sequence | CTCACAGCTCAGAGAGGACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947227747_947227752 | -6 | Left | 947227747 | 2:227856711-227856733 | CCCTGCTCCCATTCTTTCTCACA | No data | ||
| Right | 947227752 | 2:227856728-227856750 | CTCACAGCTCAGAGAGGACTTGG | No data | ||||
| 947227748_947227752 | -7 | Left | 947227748 | 2:227856712-227856734 | CCTGCTCCCATTCTTTCTCACAG | No data | ||
| Right | 947227752 | 2:227856728-227856750 | CTCACAGCTCAGAGAGGACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947227752 | Original CRISPR | CTCACAGCTCAGAGAGGACT TGG | Intergenic | ||
| No off target data available for this crispr | |||||