ID: 947229548

View in Genome Browser
Species Human (GRCh38)
Location 2:227871445-227871467
Sequence CTCTGAGGTCGCCCTTAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947229542_947229548 -5 Left 947229542 2:227871427-227871449 CCCGGCCATGCCTAGCTCCTCTG 0: 1
1: 0
2: 1
3: 22
4: 323
Right 947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
947229536_947229548 22 Left 947229536 2:227871400-227871422 CCCAGGCTGTGGCCTAGGCCGTC 0: 1
1: 0
2: 1
3: 15
4: 169
Right 947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
947229541_947229548 4 Left 947229541 2:227871418-227871440 CCGTCGGTTCCCGGCCATGCCTA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
947229540_947229548 10 Left 947229540 2:227871412-227871434 CCTAGGCCGTCGGTTCCCGGCCA 0: 1
1: 0
2: 0
3: 0
4: 59
Right 947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
947229543_947229548 -6 Left 947229543 2:227871428-227871450 CCGGCCATGCCTAGCTCCTCTGA 0: 1
1: 0
2: 3
3: 16
4: 219
Right 947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
947229537_947229548 21 Left 947229537 2:227871401-227871423 CCAGGCTGTGGCCTAGGCCGTCG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
947229545_947229548 -10 Left 947229545 2:227871432-227871454 CCATGCCTAGCTCCTCTGAGGTC 0: 1
1: 0
2: 2
3: 24
4: 235
Right 947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947229548 Original CRISPR CTCTGAGGTCGCCCTTAGTG AGG Intronic
902689406 1:18100720-18100742 TTCTGAGGTCACCCTTGGAGCGG - Intergenic
904821033 1:33244579-33244601 CTCTGATGCCACCCTTTGTGGGG + Intergenic
1064771498 10:18728302-18728324 CCCTGAGGCCTCCCTTACTGAGG + Intergenic
1065574374 10:27103227-27103249 CTCTGTGCTCCCCCTTAATGTGG - Intergenic
1079907216 11:26263628-26263650 CTCTTAGGTAGTCCTTAGTCAGG - Intergenic
1085646488 11:78226822-78226844 CTGTGAGGCTGCCCTTGGTGTGG + Exonic
1092963497 12:13618538-13618560 CTCTGGGGGGACCCTTAGTGAGG - Intronic
1105679122 13:22707190-22707212 CTCTGCCATCGCCCTTGGTGTGG - Intergenic
1119615288 14:76095028-76095050 CTCTGGGGTCTCCCTCAGTGAGG + Intergenic
1134568173 16:15268967-15268989 CTCTCAGGTGGCCCTTGATGGGG + Intergenic
1134734260 16:16487388-16487410 CTCTCAGGTGGCCCTTGATGGGG - Intergenic
1134818115 16:17222905-17222927 CTGTGAGGTTTCCCTGAGTGTGG - Intronic
1134933241 16:18224891-18224913 CTCTCAGGTGGCCCTTGATGGGG + Intergenic
1141652255 16:85399298-85399320 CTCTCAGGCCGCCCCGAGTGGGG + Intergenic
1141799983 16:86300970-86300992 CTCAGCGGTGGCCCTGAGTGAGG + Intergenic
1141917176 16:87107107-87107129 CTCTGAGGACGTTCTGAGTGTGG - Intronic
1147964842 17:44189055-44189077 CTCTGATGTCACCCTCATTGAGG + Exonic
1151954176 17:77372573-77372595 CTCTCAGGAGGCCCTTATTGTGG + Intronic
1161168845 19:2803010-2803032 CTCTGAGCCCGCGCTTACTGTGG + Intronic
1161294786 19:3514156-3514178 CTTTGAGGTGTCCCTGAGTGGGG - Intronic
925769323 2:7267064-7267086 AGCTGAGGTCGCCCTCAATGTGG + Intergenic
928378609 2:30799449-30799471 CTCTGAGGTCTGCCTTTCTGGGG - Intronic
929762349 2:44816604-44816626 CTCTGAGTCTGCTCTTAGTGTGG + Intergenic
932487057 2:72090620-72090642 TTCTGAGGTCACCCTGAGTGAGG - Intergenic
937474667 2:122204469-122204491 CTCTGAGGGCGACCTGTGTGGGG + Intergenic
947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG + Intronic
1168936430 20:1669909-1669931 CTCAGAGGCCACCCTTGGTGAGG - Intergenic
1169183490 20:3591962-3591984 CTGTGAGGTGGGCCTAAGTGTGG - Intronic
1172953976 20:38742260-38742282 ATCTGAGCTGGCCCTTAATGAGG + Intergenic
1173816608 20:45993405-45993427 CTCTAAGGTCAGCCTGAGTGGGG + Intergenic
1180793145 22:18588150-18588172 CTCTAAGGTCACTCCTAGTGTGG + Intergenic
1181228592 22:21407168-21407190 CTCTAAGGTCACTCCTAGTGTGG - Intergenic
1181250057 22:21527697-21527719 CTCTAAGGTCACTCCTAGTGTGG + Intergenic
1183483788 22:38078630-38078652 CTCTGAGGTGGCCCTGGCTGGGG - Exonic
951597695 3:24335902-24335924 CTCTGAGGTCACCTTGATTGAGG + Intronic
953971450 3:47351775-47351797 ATCTGGGGTCCCCCTTAGGGTGG + Intergenic
961562676 3:127741352-127741374 CTGTGGGGTGGCCCTGAGTGTGG + Intronic
962603765 3:137014771-137014793 CTCTAAGGTCCTCCTTAATGGGG - Intergenic
969642974 4:8410183-8410205 CGCTGGGGTGGCCCTCAGTGGGG - Intronic
970551595 4:17187117-17187139 CTCTGGGTTGGCCCTTTGTGAGG - Intergenic
978388302 4:108198721-108198743 CTCTCAGGTGGCCCTGAGTGTGG + Intergenic
980195607 4:129584102-129584124 TTCTGAGGACACCCTTCGTGAGG + Intergenic
985510729 5:312099-312121 CGCTCAGGCCGCCCTCAGTGGGG + Intronic
985643509 5:1074496-1074518 TTCTGAGGTCGGCCTTTGAGTGG - Intronic
986332344 5:6726860-6726882 GACTGAGGTCGGCCTTAGCGTGG + Intronic
988739851 5:34059573-34059595 CTCTGAGGTCTCCTTTATAGGGG + Intronic
996724607 5:126663545-126663567 CTCTGAGCTCCCCCTCAGTCTGG + Intergenic
1002070637 5:176677190-176677212 CTGTGATGTCACCCCTAGTGAGG + Intergenic
1007409255 6:41652346-41652368 CTCTGAGGCCCCCTGTAGTGTGG - Intronic
1009421635 6:63470741-63470763 CTTTGAGGTCATCCTTAGTAGGG + Intergenic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1023203607 7:37724551-37724573 CACTGAGCTCGTCCTTAATGTGG + Intronic
1029226920 7:99035046-99035068 CACTGAGGTCGCCGGAAGTGGGG - Intronic
1032489233 7:132311613-132311635 CTATGAGATAGCCCTGAGTGAGG - Intronic
1033913646 7:146296301-146296323 CTCTGAAGTAGCCCAAAGTGTGG - Intronic
1033965168 7:146966451-146966473 CTTTGACGTAGGCCTTAGTGTGG + Intronic
1036822374 8:11951183-11951205 CCCTGTGGACACCCTTAGTGAGG + Intergenic
1039790490 8:40872113-40872135 CTCTGAGGTTGCACTGACTGAGG + Intronic
1045647801 8:104316489-104316511 CTCAGAGGTAGCCCTTGGTATGG + Intergenic
1047293821 8:123553426-123553448 CTCTGGGCTCGCCCTTGCTGTGG - Intergenic
1049528643 8:143142494-143142516 GTCTGAGGTCCCCCTGTGTGAGG - Intergenic
1049528744 8:143142825-143142847 GTCTGAGGTCCCCCTGTGTGAGG - Intergenic
1049563761 8:143326706-143326728 TTCTGCAGTTGCCCTTAGTGCGG - Intronic
1060820890 9:126661200-126661222 CTGAGAGGTCGCCCTGCGTGGGG - Intronic
1060820899 9:126661236-126661258 CTGGGAGGTCGCCCTGCGTGGGG - Intronic
1060820910 9:126661272-126661294 CTGAGAGGTCGCCCTGCGTGGGG - Intronic
1062023756 9:134331071-134331093 CACTGAGGTAGCCCTTTCTGTGG + Intronic
1188063630 X:25630902-25630924 CTTTGAGGTGGCCATTGGTGGGG + Intergenic
1189752199 X:44233739-44233761 TTCTCAGGTCGCCTATAGTGGGG + Intronic
1190729805 X:53218198-53218220 CTCTGGGGGCCCCCTTAGTTTGG - Intronic
1190734768 X:53248964-53248986 CTCTGAGGCCGGACTTAGTTGGG - Intronic
1196428981 X:115602036-115602058 CTCTGAGAATGCCCTTACTGGGG + Intronic
1197633110 X:128884823-128884845 CCACTAGGTCGCCCTTAGTGTGG - Intergenic
1197753239 X:129979894-129979916 CACTGAGGTCGCCCAGGGTGGGG + Intergenic
1198440314 X:136656837-136656859 CCCTGAGGTTGGCCTCAGTGAGG - Intronic