ID: 947231194

View in Genome Browser
Species Human (GRCh38)
Location 2:227888389-227888411
Sequence AAGCAGAAGCAGGATCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947231194 Original CRISPR AAGCAGAAGCAGGATCAGGC GGG Intronic
900108071 1:993973-993995 AAGGAGAAGAGGGAGCAGGCAGG - Intergenic
901822735 1:11840514-11840536 AAGCAGAGGTAGAATCAGGCGGG + Exonic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902229576 1:15019315-15019337 AGGCAGAGCCAGGTTCAGGCTGG - Intronic
902259694 1:15215302-15215324 AAGCAGCAGCAGCATCACCCCGG - Exonic
903146011 1:21372419-21372441 AGACAGAAGCTGGATCAGCCTGG - Intergenic
903437245 1:23359841-23359863 AAGCAGCAGCAGGAACTGGTTGG + Exonic
904004719 1:27357706-27357728 GAGCAGAAGCAAGAGCAGGTGGG - Exonic
904533709 1:31185335-31185357 AAGCAGAGGTGGGATCAGGGTGG + Intronic
906174038 1:43753899-43753921 AGGCAGGAGCAGGATCTGGGCGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908809016 1:67960091-67960113 GAGGAGCAGCAGGATCAGGAGGG - Intergenic
908988457 1:70055257-70055279 AAGCAGAAGCCGGATCATGCTGG + Intronic
909177740 1:72381485-72381507 AAGCAGAAGCTGGAACAGTTTGG - Intergenic
909603068 1:77480922-77480944 GAGGAGAAGCAGGATAGGGCAGG + Intronic
909722948 1:78797343-78797365 AAGCAAAAGCAAGATCAGCACGG - Intergenic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
910894058 1:92049120-92049142 AAGCAGAAGCCTGATCATGTAGG - Intronic
911362398 1:96895011-96895033 GAGCTGAAGCAGGATCAGGGTGG + Intergenic
911553426 1:99312731-99312753 AAGCAGAAGTAGGAGTAGGAGGG + Intergenic
912664665 1:111568327-111568349 AAGGCAAAGCAGGAGCAGGCAGG + Intronic
913012376 1:114697095-114697117 AAGGAGAAGCAGGTTCATGGAGG - Intergenic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
914819489 1:151089784-151089806 AAACAAAAAAAGGATCAGGCTGG - Intronic
915127995 1:153679137-153679159 GAGCAGGAGCAGGCGCAGGCGGG - Exonic
915331257 1:155113893-155113915 AAGCAGAAGCAGGAGCCAGTTGG + Intergenic
915538918 1:156555166-156555188 AAGCAGAAGAAGGACAGGGCAGG - Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
917029540 1:170673696-170673718 AAGCTGTAGGAGGATCAGACTGG - Intronic
917844176 1:179006585-179006607 CCTCAGAAGCAGGACCAGGCCGG + Intergenic
918002146 1:180507977-180507999 GAGCAGAAAAAGGAGCAGGCAGG + Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
920636020 1:207704440-207704462 AAGCAGCAGCAGTATCTGGGAGG + Intronic
921523392 1:216186282-216186304 AAGCAGAAGCTGGAACATGAAGG - Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923308649 1:232712280-232712302 AAGCAAAAGCAGGTTTTGGCAGG - Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
1062782318 10:225447-225469 AAGCTGAGGCAGGAGGAGGCTGG - Intronic
1063182912 10:3622115-3622137 AAGCAGAAGCAAATACAGGCAGG + Intergenic
1063443029 10:6088984-6089006 AAGCAGGCGCAGGCGCAGGCGGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065114896 10:22476011-22476033 AAGCATGAGCAGGAAGAGGCTGG + Intergenic
1066693587 10:38057948-38057970 GAGCAGAACCAGAATCAAGCTGG + Exonic
1067382440 10:45787406-45787428 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067787932 10:49264487-49264509 AAGCAGGACCAGGGCCAGGCCGG + Intergenic
1067890138 10:50127954-50127976 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1068947325 10:62742586-62742608 AAACAGATGAAGGATGAGGCAGG - Intergenic
1069518920 10:69102110-69102132 AGGAAGAAACAGGATAAGGCAGG - Intronic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1073452740 10:103619272-103619294 GAGCAGAACCAGGAGCAGGCAGG - Intronic
1075494530 10:122908519-122908541 AAGCAGCAGCAGGCTTAGGGAGG + Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076209957 10:128632433-128632455 AAGCAGATGCAGGAGTGGGCAGG + Intergenic
1076293220 10:129363659-129363681 AAACAGAAGCAGAACCAGTCAGG - Intergenic
1076583050 10:131526997-131527019 AAGCAAAAGAAGGTTAAGGCAGG + Intergenic
1077259491 11:1608216-1608238 CAGCTGGAGCAGGAACAGGCTGG + Exonic
1077261204 11:1621882-1621904 CAGCTGGAGCAGGAACAGGCTGG + Exonic
1077483268 11:2826522-2826544 AAGCAGCAGCAGGAGGGGGCGGG - Intronic
1077985839 11:7350097-7350119 AGGCTGAATAAGGATCAGGCTGG + Intronic
1079974397 11:27074359-27074381 AAGCAGAAGTTGGAACAGTCTGG + Intronic
1080014163 11:27487334-27487356 AAGCAGAAGCTGGATTATGCAGG + Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083443223 11:62690456-62690478 AAGCAGGAGCAGGAGCAGGCAGG + Exonic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1084410484 11:69003635-69003657 GAGCAGAGCCAGGAGCAGGCAGG - Intergenic
1084605359 11:70168972-70168994 AAGCTGAACCAGGGTCAGGCCGG + Intronic
1084798781 11:71527448-71527470 CAGCTGGAGCAGGAACAGGCTGG - Exonic
1084800112 11:71538182-71538204 CAGCTGGAGCAGGAACAGGCTGG - Exonic
1084803885 11:71565756-71565778 CAGCTGGAGCAGGAACAGGCTGG - Exonic
1084806481 11:71582668-71582690 CAGCTGGAGCAGGAACAGGCTGG + Exonic
1085312526 11:75525102-75525124 AAGCAGAGGCTGGAACTGGCTGG - Intronic
1086037930 11:82439300-82439322 AAGGAGAAGCCGGAGAAGGCTGG - Intergenic
1086080714 11:82900367-82900389 AGACAGAAGCAGGAGCAGGAGGG + Exonic
1086898711 11:92342072-92342094 AAGCAGACACAGGCTCAAGCAGG - Intergenic
1087235030 11:95708623-95708645 AAGGAGAAGCATGATCTAGCCGG + Intergenic
1087515569 11:99154963-99154985 AGACAGTAGCAGAATCAGGCTGG + Intronic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089278601 11:117356527-117356549 AAGCAGCAGCACCCTCAGGCAGG + Intronic
1089439875 11:118506305-118506327 AAGCAGAATCAAGATCACGCTGG - Exonic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089561623 11:119346074-119346096 AAGCAGCAGGAGGAGCAGGCTGG + Exonic
1089829682 11:121315934-121315956 AAGCTGAAGGAGGATCAGAAAGG - Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1091041446 11:132284979-132285001 AAGCATGAGCAGGAGCAGGAAGG + Intronic
1094241883 12:28237585-28237607 TATCAGAAGCTGGAACAGGCAGG + Intronic
1096105774 12:48996436-48996458 AGGCCTAACCAGGATCAGGCAGG - Exonic
1096494911 12:52034180-52034202 AAGAAGAGACAGGACCAGGCAGG - Intronic
1096689898 12:53314152-53314174 AAGCAGAAGTAAGATCAAGGTGG - Intronic
1098052589 12:66470247-66470269 AAGCAGAAGCCAGATCATGCAGG - Intronic
1098594047 12:72250396-72250418 AGGCAGTAGGAGGATCACGCTGG + Intronic
1098849240 12:75575377-75575399 ATGCAGCAGGAGGATCTGGCAGG - Intergenic
1098884982 12:75951902-75951924 AGCCAGAAGCATGATCAAGCTGG + Intergenic
1100205212 12:92341165-92341187 AAGCAGAGACAGGAGCAAGCTGG + Intergenic
1101737239 12:107472166-107472188 CAGCAGAGGCAGGTTTAGGCTGG + Intronic
1101816091 12:108147281-108147303 CAAGAGAAGCAGGGTCAGGCGGG + Intronic
1104110571 12:125700580-125700602 TAGCACAAGCAGGGTCAGACTGG + Intergenic
1104458550 12:128935096-128935118 CAGCAGAAGCAAGTACAGGCGGG + Intronic
1104965849 12:132508517-132508539 TAGCAGAGGCAGGAGCCGGCTGG + Intronic
1105590672 13:21790379-21790401 AACAAGAAACAGAATCAGGCTGG + Intergenic
1106054277 13:26223341-26223363 AAGCAGAAGAAAGATCTGGAAGG - Intergenic
1106666058 13:31852113-31852135 GGGAAGCAGCAGGATCAGGCAGG + Intergenic
1108601214 13:51996775-51996797 AAGAAGCAGCAGGATAAAGCAGG - Intronic
1112781225 13:102903233-102903255 AAGCTGATGCAGGAGCAGGGTGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1114081970 14:19209077-19209099 AAGATGAAGAAGGAGCAGGCAGG - Intergenic
1114643155 14:24238120-24238142 AAGCAGAAGGAGGAAGACGCTGG + Intronic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1115312172 14:31990165-31990187 AAATATAAGCAGGATCAGCCAGG - Intergenic
1117015358 14:51512311-51512333 AATCTGAAGCAGGAGCAGGGAGG - Intronic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1119170685 14:72533956-72533978 AAGCAGCAGCAGGATTTGACGGG + Intronic
1119650226 14:76377833-76377855 AACTAGAAGCAGGAACAGTCTGG - Intronic
1119693087 14:76692041-76692063 AAGCGGAGGCAGGAACCGGCAGG + Intergenic
1121629999 14:95415019-95415041 AAGGAGAAGCTGGAACATGCGGG - Intronic
1122197091 14:100096363-100096385 AAGCAGAGTCTGGATGAGGCCGG - Intronic
1122282066 14:100629378-100629400 AAGCAGAAGCTCGCTGAGGCTGG + Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122979721 14:105186003-105186025 AAGCTGGAGGAGGATCAGGATGG + Intergenic
1124057477 15:26255354-26255376 AAGAAGAGGCAGGCTGAGGCAGG - Intergenic
1124443505 15:29707554-29707576 AAGCAGAAGCACTTGCAGGCAGG - Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124904840 15:33858659-33858681 AGCCAGCAGCAGGATCAGGTTGG + Intronic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126686127 15:51250470-51250492 AACCAGAAGCACCATCAGACAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1131139347 15:89964439-89964461 CAGCAGCAGCAGGATCAGTCAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1133532927 16:6672674-6672696 AAGCAGAAGCGGAATCATGGTGG - Intronic
1133737519 16:8627270-8627292 AAGCAGAGGCTGGGTCAGGCTGG - Intronic
1133807426 16:9136101-9136123 AAGCGGAGGGAGGAGCAGGCAGG + Intergenic
1134441362 16:14301573-14301595 AAGTAGGAGCAGCATCAGGCAGG - Intergenic
1134552955 16:15146536-15146558 AGGCACAAGCAGGAGTAGGCCGG + Intergenic
1135197042 16:20403208-20403230 AAGCAGAGGCAGGATCAGTAAGG - Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136160052 16:28414098-28414120 CAGCAAAAGCAGTTTCAGGCTGG + Intergenic
1136203036 16:28701194-28701216 CAGCAAAAGCAGTTTCAGGCTGG - Intronic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137673936 16:50294569-50294591 CAGCAGCAGCAGGAGCACGCAGG - Intronic
1138186390 16:54981052-54981074 AAGGCCAAGCAGGGTCAGGCCGG + Intergenic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1140992770 16:80230451-80230473 AATGAGAATCAGCATCAGGCTGG - Intergenic
1141656664 16:85420406-85420428 AAGCTAACACAGGATCAGGCAGG + Intergenic
1142001721 16:87668132-87668154 AAGGAGGAACAGGCTCAGGCAGG - Intronic
1142045781 16:87924454-87924476 AGGCAGGAGCAGGCTCAGGCTGG + Intronic
1142695077 17:1628964-1628986 GAGCAGAAGCCGGTTCCGGCCGG + Intergenic
1142700266 17:1655514-1655536 ACGCAGAATCAGGATGAGACGGG + Exonic
1143140427 17:4739292-4739314 AAGCAGGAGCAGGAGCACGCGGG + Exonic
1143178279 17:4968784-4968806 AAGCAGAACCAGGAGCTGGAAGG - Exonic
1143306402 17:5950786-5950808 AACCAGAATCAGCATCAGGGTGG - Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148339356 17:46864101-46864123 ACGCACAGGCAGGCTCAGGCTGG - Intronic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151318853 17:73340533-73340555 AAGCAGAAGCTGGACCAAGATGG - Intronic
1151604185 17:75125874-75125896 AAGCAGCACCTGGGTCAGGCTGG - Intronic
1151727981 17:75895450-75895472 CAGCAGGGGCAGGATCGGGCAGG - Intronic
1152260563 17:79264685-79264707 AAACAGAAACAGCATCAGGTGGG - Intronic
1152395404 17:80030023-80030045 ATGCAATCGCAGGATCAGGCAGG - Intronic
1156508279 18:37613051-37613073 AAGGAGACCCAGGAGCAGGCTGG - Intergenic
1157363276 18:47038991-47039013 AAGCAGAAACAGGCTCTGTCTGG + Intronic
1158591917 18:58785182-58785204 AGGGAGAAGTGGGATCAGGCTGG - Intergenic
1158896744 18:61921352-61921374 GTGCAGAGGCAGGATCAGCCAGG - Intergenic
1158989599 18:62854991-62855013 AAAAAGCAGCAGGATCAGGCTGG - Intronic
1159960410 18:74551141-74551163 AAGGTGAAGCAGGAACAGGCAGG - Intronic
1160656493 19:274422-274444 AAGCAGCAGCAGGATTTGACAGG + Intergenic
1160749388 19:726908-726930 CAGAGGAAGCAGGATCGGGCTGG + Intronic
1160993625 19:1871902-1871924 CAGCAGGGGCAGGATCCGGCTGG + Intergenic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1162217362 19:9147630-9147652 AAACAAAACCAGGATCAGCCGGG - Intronic
1162752586 19:12838166-12838188 GAGCAGAAGCAGGGTAAGACAGG - Intronic
1163175389 19:15561073-15561095 GACCTGAAGCTGGATCAGGCAGG + Intergenic
1163531482 19:17851966-17851988 AAGAAAAAGCAGGCTGAGGCAGG + Intergenic
1164273800 19:23699332-23699354 AGGCAGAGGCAGGATTAGACCGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1165084001 19:33329995-33330017 AAGCAGGGGCTGGATCATGCTGG - Intergenic
1166944684 19:46389808-46389830 AAGCAGGAGCAGGAAGGGGCAGG - Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167655257 19:50759519-50759541 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
1167657059 19:50771750-50771772 AAGAAGAGGCAGGATTTGGCAGG - Intergenic
925250395 2:2430895-2430917 CAGCAGAAGGAAGAGCAGGCTGG + Intergenic
925478758 2:4247491-4247513 ATGCAGCAGCAGGGCCAGGCTGG - Intergenic
925741241 2:7007667-7007689 CATCAGAGGCAGGAACAGGCAGG - Intronic
926086745 2:10025094-10025116 AAACAAACGCAGCATCAGGCAGG + Intergenic
926240400 2:11080869-11080891 AGGCAGAAACAGGGCCAGGCCGG + Intergenic
927469234 2:23359967-23359989 AAGGAGAAGAAGGCCCAGGCAGG - Intergenic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
928437038 2:31261429-31261451 AAGTAGGAGCAGGAGGAGGCGGG + Intronic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931841879 2:66159980-66160002 AAGCAGAGGGAGGCTGAGGCAGG + Intergenic
932345788 2:70994529-70994551 CAGGAGGGGCAGGATCAGGCGGG + Intronic
933085008 2:78045244-78045266 AAGCAGAAGCTGGAACAGTTTGG + Intergenic
933304255 2:80577592-80577614 GAGCAGAAGCAAGATCAGTTAGG + Intronic
933677187 2:85067211-85067233 AGGCAGAAGCAAGCTCAGGGAGG - Intergenic
933983212 2:87570378-87570400 AAGCAGCAGCAGGGCCTGGCAGG - Intergenic
934568515 2:95353679-95353701 AAGCAGAAGTGGGTGCAGGCGGG + Intronic
935109312 2:100077320-100077342 AAGCAAAAGAAGGAGCAGGAAGG + Intronic
935191421 2:100781721-100781743 AGGCTGATGCAGCATCAGGCTGG - Intergenic
935265647 2:101391639-101391661 TATAAGAAGCAGCATCAGGCTGG + Intergenic
935723165 2:105997532-105997554 AAACGGAAGCAGGAACAAGCTGG + Intergenic
936241829 2:110794504-110794526 TAGCAGTAGCAGGAACAGACTGG + Intronic
936310633 2:111380416-111380438 AAGCAGCAGCAGGGCCTGGCAGG + Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
937939748 2:127275858-127275880 AAGCAGAAGCTGGAGCCGGCAGG + Intronic
937971332 2:127551653-127551675 AAGCAGAGGCGGGAGAAGGCAGG + Intronic
938063607 2:128269734-128269756 AAGTAGAACCAGGGCCAGGCAGG + Intronic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938166148 2:129028698-129028720 AGGCAGAAACAGGACCAAGCAGG + Intergenic
938494614 2:131787521-131787543 AAGATGAAGAAGGAGCAGGCAGG + Intergenic
938966703 2:136394979-136395001 AAGCAGAATCAGCATCAGCTGGG - Intergenic
939955395 2:148523720-148523742 AAGCAGAAGCCAGATCATGGTGG + Intergenic
940415200 2:153411625-153411647 AAGCAGGTGCTGGATCATGCTGG + Intergenic
942115036 2:172720552-172720574 AAGGAGAAGTAGGATCACACAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
943707995 2:191056370-191056392 AAGAAGCAACAGGATGAGGCTGG + Intronic
946169852 2:217888421-217888443 AAGCAGAGGCAGTGTCAGACAGG + Intronic
946651661 2:221898050-221898072 AATCAGAGGCAGGATAAGACTGG - Intergenic
947204580 2:227648553-227648575 AAGCAGCAGCAGCACCAGGTAGG + Intergenic
947205709 2:227659242-227659264 ACGAAGAATCAGGACCAGGCAGG - Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947499000 2:230658814-230658836 GAGCAGGAGCAGGAGCAGGCAGG + Intergenic
1170185341 20:13583257-13583279 AGGCAGAGGCAAGCTCAGGCTGG - Intronic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171188557 20:23141705-23141727 GAGCAGCAGCAGGTGCAGGCAGG + Intergenic
1171278771 20:23879722-23879744 AAGCAGCAGAAGGCTGAGGCAGG + Exonic
1171544692 20:25991118-25991140 AAGCAGAAGATGGATCAAGAAGG + Intergenic
1172134317 20:32676747-32676769 AAACAGAGGCTGGATCATGCAGG + Intergenic
1173909735 20:46657780-46657802 AAGGCGAACCAGGAGCAGGCAGG + Intronic
1175159488 20:56997245-56997267 AAGCAGCAAGAGGATCAGGTTGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175637488 20:60598069-60598091 AAGCAGAAGCAGAATCTTACAGG + Intergenic
1176049494 20:63110194-63110216 AAGATGAAGGAGGAGCAGGCAGG + Intergenic
1176057323 20:63155593-63155615 CAGCAGGAGCAGGCTCAGGACGG + Intergenic
1176360185 21:5988718-5988740 CAGCAGCAGCAGCATCTGGCAGG - Intergenic
1176613315 21:9006750-9006772 AAGTTGAAGAAGGAGCAGGCAGG - Intergenic
1176711858 21:10157042-10157064 AAGATGAAGAAGGAGCAGGCAGG + Intergenic
1177860037 21:26441433-26441455 AAGGAGAAAAATGATCAGGCAGG - Intergenic
1178918511 21:36723018-36723040 AAGCAGGAGCAAGATGAGGTTGG - Intronic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1179608322 21:42532718-42532740 AAACACAAGCAGGAGCAGCCAGG + Intronic
1179631579 21:42681979-42682001 AGTCAGGAGCAGCATCAGGCTGG + Intronic
1179763333 21:43549832-43549854 CAGCAGCAGCAGCATCTGGCAGG + Intronic
1179840849 21:44072312-44072334 ATGCAGAAGCAAGAGCAGCCAGG - Intronic
1180498803 22:15913593-15913615 AAGATGAAGAAGGAGCAGGCAGG + Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181591625 22:23889132-23889154 CAACAGAGGCAGGATCAGGGTGG - Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182441866 22:30369425-30369447 AAGCAGCAGCAGGAGCCTGCGGG - Exonic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182557417 22:31136804-31136826 GAACAGAGGCAGGCTCAGGCCGG + Intronic
1182715094 22:32351935-32351957 AAGCAGAAGAAAAACCAGGCTGG + Intergenic
1183323685 22:37180221-37180243 AGGCAGGGGCAGGATCAGGCAGG + Exonic
1183910290 22:41074192-41074214 AAGCAGAAGTATGACCAGTCCGG - Intergenic
1184100122 22:42337606-42337628 ATGCAGGAGAAGGATCAGGCAGG - Intronic
1184141120 22:42577883-42577905 AAGGAGAAGCTGGAGCTGGCTGG - Intergenic
1184480513 22:44744176-44744198 ATGAGGATGCAGGATCAGGCGGG + Intronic
1184484185 22:44766085-44766107 ATGCAGACCCAGGATCAGGTTGG - Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
950575931 3:13832069-13832091 AAGCAGGAGCAGGAACAGGAGGG - Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
951601242 3:24378112-24378134 AGGCAGAAACTGAATCAGGCAGG + Intronic
951880563 3:27477714-27477736 AGGCTGAGGCAGGATGAGGCGGG - Intronic
952157167 3:30655910-30655932 CAGCAGCAGCAGGATCACCCGGG + Intronic
952438689 3:33300083-33300105 AATCATAAGCAGCTTCAGGCAGG + Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953227214 3:41031591-41031613 AAGCAGAAGCACCAACTGGCTGG + Intergenic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954437156 3:50502538-50502560 CAGCAGCAGCAGGCGCAGGCAGG + Intronic
954715410 3:52524372-52524394 AAGCAGAAGCATGCACAGGGAGG + Exonic
958657204 3:97018031-97018053 AAGCAGAAGAAGGATTAGTGAGG - Intronic
959077036 3:101760180-101760202 AAAAAGAAGCAGCATCAGACAGG - Intronic
961830934 3:129622736-129622758 AAACACAGGCAGGGTCAGGCAGG + Intergenic
962196075 3:133364867-133364889 TAAGAGAAGCCGGATCAGGCAGG + Intronic
965719928 3:171650435-171650457 AAGCAGATGCCAGAACAGGCCGG + Intronic
966916590 3:184587660-184587682 AAACAGACTCAGGATCTGGCTGG + Intronic
968064041 3:195748244-195748266 AAGCAGCAGCCAGATCAGGTGGG + Intronic
968882073 4:3306251-3306273 AAGCGGAAGGAGGAGCTGGCTGG + Intronic
969033514 4:4231840-4231862 AAGCAGAAACTGGAAGAGGCTGG - Intergenic
969940227 4:10724750-10724772 AAGCAGGAGCAGGTACAGCCTGG + Intergenic
971425536 4:26511441-26511463 AGCCAGAAGCAAGAGCAGGCTGG - Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
977705288 4:100063984-100064006 AGGCACAAGCAAGATCAGGCAGG + Intergenic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
979333245 4:119440113-119440135 AGGAAGAAGCAGGCCCAGGCTGG + Intergenic
979383672 4:120038298-120038320 TAGCAGAAGCACCATCAGGTTGG + Intergenic
980378129 4:131976434-131976456 AAGCAGAAGAACGATCAAGGAGG - Intergenic
981052834 4:140328052-140328074 AAGCAGAAGCACGAGGAGTCTGG - Intronic
981632599 4:146837731-146837753 AAACAGAGCCAGGATCAGGATGG + Intronic
983188444 4:164728076-164728098 AAGCAGGAGCAGGCTCAGAGGGG - Intergenic
983524709 4:168749178-168749200 AAGGTGAAGCAGGAGCAGGCAGG - Intronic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
983967578 4:173831800-173831822 AAGGTGAAGCAGGAGCACGCAGG + Intergenic
983999748 4:174225605-174225627 AGGCAGAAGCCGTATCTGGCAGG - Intergenic
984821436 4:183886046-183886068 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821453 4:183886150-183886172 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821461 4:183886202-183886224 AGGCAGATGCAAGATCAGGAAGG + Intronic
984821469 4:183886254-183886276 AGGCAGATGCAAGATCAGGAGGG + Intronic
985756189 5:1719930-1719952 CAGCAGGAGCAGGATGTGGCAGG + Intergenic
985934036 5:3080740-3080762 AAGCAGAGGCAAGATCATGGTGG + Intergenic
986195284 5:5532581-5532603 GAGCAGAAGGAAGACCAGGCAGG - Intergenic
987867863 5:23569570-23569592 AGGCTGAAGCAGGAGAAGGCAGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989358528 5:40572498-40572520 AAGCAGAAACAGCAGCAGACCGG + Intergenic
989484558 5:41974646-41974668 AACAACATGCAGGATCAGGCAGG - Intergenic
989559208 5:42831816-42831838 AAACACAAGCAGGGACAGGCCGG - Intronic
989575361 5:42982849-42982871 AAGCAGGAGAAGGCTAAGGCAGG - Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
990529277 5:56657696-56657718 AGGCAGAAGCAGGAGCAAGGAGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
992558033 5:77922272-77922294 AAGGTGAAGGGGGATCAGGCAGG - Intergenic
992625227 5:78630800-78630822 ACGCAAAAGCAGAATAAGGCGGG + Intronic
992689858 5:79231663-79231685 GGGCAGAGGCAGAATCAGGCAGG - Intronic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
994961209 5:106604995-106605017 AAGCAGCAGCAGGATCTGAGAGG + Intergenic
996096546 5:119405228-119405250 AAGCAGAGGGTGGAACAGGCAGG - Intergenic
997091161 5:130860269-130860291 AAGCAGCAGTAGGATGAGGGAGG - Intergenic
997595738 5:135106185-135106207 AAGGAGAAACAGAATCAGTCGGG + Intronic
997736595 5:136216824-136216846 AAGCAGAAGCAGACACAGCCGGG + Intronic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
998329744 5:141314268-141314290 AAACAGAAGCAGCATCATTCTGG - Intergenic
998478045 5:142437852-142437874 AAGCAAAAGAAGGATTAGACTGG - Intergenic
998537900 5:142951489-142951511 TAGCAGAAGGAGGATCAGTCTGG + Intronic
999255436 5:150207435-150207457 TAGTAGAAACAGGACCAGGCTGG + Intronic
999411272 5:151351946-151351968 AGGCAGCAGCTGGATCATGCAGG - Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001904853 5:175463180-175463202 GAGAGGAAGCAGGATTAGGCAGG + Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1003710430 6:8583569-8583591 AAGCAGAAGCATGAGAAGACAGG - Intergenic
1004571652 6:16851652-16851674 AATCATTAGTAGGATCAGGCGGG - Intergenic
1004595035 6:17091856-17091878 AAGAACTAGCAGGATCTGGCCGG + Intergenic
1004607410 6:17206803-17206825 AGGCTGAAGCCGGCTCAGGCGGG - Intergenic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1007222945 6:40293469-40293491 CAGCAGGAACAGCATCAGGCTGG - Intergenic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007531827 6:42549523-42549545 AAAAAGAAACAGGATCAGGCTGG - Intergenic
1008077388 6:47159328-47159350 AGGCAGAAGCTGGATCATGTGGG + Intergenic
1011400711 6:86958428-86958450 AAACAGAAACAGGAACAGACTGG - Intronic
1011494527 6:87925345-87925367 AAGCAGCACCAGGCTCAGCCAGG + Intergenic
1012977499 6:105795799-105795821 AAGCAAAAAGAGGGTCAGGCAGG + Intergenic
1014544895 6:122723072-122723094 AAGCTGAAGGAGGAGCAGCCAGG - Intronic
1014620837 6:123665160-123665182 AAGCAGAAGCAGGGTTGGGGTGG - Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1016343948 6:143090948-143090970 AAGCAGCAGCAGGATCTGAGAGG - Intronic
1016808217 6:148234527-148234549 AAGAAGAAGGAGGAACTGGCCGG + Intergenic
1016875792 6:148863842-148863864 TTCCAGAAGAAGGATCAGGCAGG - Intronic
1017254887 6:152322787-152322809 AAGCAGAAGCCTGAGCGGGCTGG - Intronic
1017422003 6:154282384-154282406 AAGAAGTAGATGGATCAGGCAGG + Intronic
1018579145 6:165292694-165292716 AAGGAGAAGCAGAGTCAGCCTGG + Intronic
1020268089 7:6574998-6575020 AGGCTGAGGCAGGATGAGGCAGG - Intergenic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1021614096 7:22485118-22485140 AAGCAGTAGCAGGATCTGAGAGG + Intronic
1021636397 7:22698399-22698421 AACCAGAAACAGAGTCAGGCTGG - Intergenic
1022488125 7:30795873-30795895 AAGCAGAAGAGGGAGCAGGAAGG - Intronic
1022647573 7:32245475-32245497 AAGCAGAACGAGGATTGGGCTGG - Intronic
1023372106 7:39522025-39522047 AGGCTGAGGCAGGATGAGGCAGG + Intergenic
1024223327 7:47304714-47304736 AAGCTGAAGCTAGACCAGGCAGG - Intronic
1025898832 7:65727505-65727527 ACACAGAAGCAGACTCAGGCGGG + Intergenic
1026287470 7:68975911-68975933 AAGCAGTGGCAGGGACAGGCAGG - Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1027579223 7:79972726-79972748 AAGAGGAAGAAGCATCAGGCAGG - Intergenic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1028550237 7:92053149-92053171 AAACAAAAGCAGGATCATGTAGG - Intronic
1029624352 7:101710586-101710608 AAGCAGAAACAGGATGTGCCTGG + Intergenic
1030324282 7:108203543-108203565 AAGGAGAAGCTGGTTCAGGGAGG - Intronic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1031431509 7:121676411-121676433 AAGAGGAATCAGGAGCAGGCAGG + Intergenic
1031995460 7:128227487-128227509 AATCAGAAGCACCATCAGGAAGG - Intergenic
1032415700 7:131733741-131733763 AATCACAAGCAGGATAAAGCTGG + Intergenic
1032419174 7:131764293-131764315 TGACAGAAGCAGGAGCAGGCTGG - Intergenic
1032778059 7:135136187-135136209 AAGCATAAGAAGGGTCAGGTAGG + Intronic
1033465613 7:141586733-141586755 GAGCAGAAGCAGCATCAAGGGGG + Intronic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1034069885 7:148174346-148174368 GAGCAGAGACAGCATCAGGCTGG - Intronic
1034875282 7:154719979-154720001 AAGCAGATGCAGGAGCATGGGGG - Intronic
1035098302 7:156375008-156375030 TAGTAGAGGCAGGGTCAGGCTGG + Intergenic
1035756640 8:2037724-2037746 CTGCAGAAGCATGATCAGGTGGG + Intergenic
1036084723 8:5600977-5600999 AAGCAGATGCAAGACCAGCCTGG + Intergenic
1036948424 8:13117816-13117838 AAGCAGGAGCATGCTCTGGCAGG - Intronic
1037269307 8:17108690-17108712 AAGCAGAAGGATGATCTGGGGGG - Intronic
1037977847 8:23225778-23225800 AACCAAAAGCAGGATGAGCCGGG - Intergenic
1038231624 8:25705934-25705956 AAGCAAAAGCAGGCTCATGGAGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039929513 8:41971756-41971778 AAGCAGAAGCAAGTTTAGTCTGG + Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1040594359 8:48823095-48823117 ATGCTGAACCAGGGTCAGGCAGG + Intergenic
1040941362 8:52836633-52836655 AAGGAGAGGCAGGATCAGAGTGG + Intergenic
1042030556 8:64471257-64471279 GAGCTGAAGCAGGATTTGGCAGG - Intergenic
1042105066 8:65317396-65317418 AAGGGGAAGCAGGTACAGGCAGG + Intergenic
1044111287 8:88278446-88278468 AAGCATAAGAAGTATAAGGCTGG + Intronic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045491309 8:102671360-102671382 AAGCAGGAGGAGGATCAGAGGGG - Intergenic
1048212777 8:132469310-132469332 AAGCTGTAGAAGGATCAGGTGGG - Intronic
1048823000 8:138396855-138396877 AAGCAGAAGCAGGTGCTGTCTGG - Intronic
1049150962 8:141035255-141035277 AACCAGAAGCTGGAAGAGGCAGG + Intergenic
1049510034 8:143022682-143022704 AAGAAGGAGCACGCTCAGGCTGG + Intronic
1049946884 9:605694-605716 GAGAATAAGCATGATCAGGCTGG + Intronic
1051596523 9:18829812-18829834 AGGCAGAGGGTGGATCAGGCAGG - Intronic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052563926 9:30122152-30122174 AAGCAGAAGCAAGACAAGGGGGG + Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053648856 9:40142730-40142752 AAGATGAAGAAGGAGCAGGCAGG + Intergenic
1053756888 9:41321123-41321145 AAGATGAAGAAGGAGCAGGCAGG - Intergenic
1054535727 9:66233440-66233462 AAGATGAAGAAGGAGCAGGCAGG - Intergenic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1054881521 9:70149366-70149388 GAAAGGAAGCAGGATCAGGCAGG + Intronic
1056586222 9:87929104-87929126 AAGTAGAAGCAGGTTCAGAAGGG - Intergenic
1056610660 9:88123839-88123861 AAGTAGAAGCAGGTTCAGAAGGG + Intergenic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1057089177 9:92240895-92240917 ATGCACAAGCAGGACCAGGAAGG + Exonic
1057132660 9:92664873-92664895 ATGCAGAAGGAGGCTCAGTCAGG + Intronic
1058904273 9:109469042-109469064 AACCAGAAGCAGTAGCATGCTGG + Intronic
1059150254 9:111943062-111943084 GAGCAGAAGAAGGGTGAGGCTGG - Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059759067 9:117321216-117321238 ATGCAGTAGAAGAATCAGGCAGG + Intronic
1059852919 9:118363971-118363993 AAGCAGCAGCGGGGTCAGGTAGG + Intergenic
1060896686 9:127223437-127223459 GAGAAGGAGCAGGATGAGGCTGG + Intergenic
1061002679 9:127911167-127911189 AGGCAGAGGCAGGATCACGCAGG + Intronic
1061389545 9:130309881-130309903 AAGAGGAAGAAGCATCAGGCCGG - Intronic
1061510434 9:131057656-131057678 AAGAGGAAGCAGGCTCAGGGAGG - Intronic
1061625192 9:131837306-131837328 AAGCAGGAGCTGGAGCAGCCTGG + Intergenic
1062366797 9:136213779-136213801 AAGTAGCACCAGGTTCAGGCAGG - Intronic
1062434297 9:136539888-136539910 AAGAGGAAGGAGGCTCAGGCGGG - Intronic
1202796612 9_KI270719v1_random:126031-126053 AAGATGAAGAAGGAGCAGGCAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1188179354 X:27034806-27034828 GAGCAGAAGCTTGATCACGCAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189627690 X:42916893-42916915 AACAAGCAGCAGAATCAGGCTGG + Intergenic
1190236075 X:48616768-48616790 AGGAGGAAGCAGGATCGGGCAGG + Intergenic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1195235815 X:102897227-102897249 AAGGAGAAGAAGGATAAGGGAGG + Intergenic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1197982051 X:132227483-132227505 AAGGTCAAGCAGGAGCAGGCAGG + Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198708425 X:139475197-139475219 AAGCAGAAGGTGGATAAGGTTGG + Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic