ID: 947232003

View in Genome Browser
Species Human (GRCh38)
Location 2:227897400-227897422
Sequence TGCTTTAGGATATATGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947232003 Original CRISPR TGCTTTAGGATATATGTGTT GGG Intronic
901709645 1:11103733-11103755 TTCTTTAGGATATAAGAGTCTGG - Intergenic
903937585 1:26907169-26907191 TGCCTTTGCATATATCTGTTTGG + Intronic
906336593 1:44937522-44937544 GGATTTGGAATATATGTGTTCGG + Intronic
907427329 1:54388668-54388690 TGCCTTGGGATATATCTGTAAGG + Intronic
909074024 1:71031447-71031469 TGGTTTATGACATATGTGCTGGG - Intronic
909968366 1:81947602-81947624 TGATTTAGCATTTATGTGCTAGG - Intronic
910245174 1:85131096-85131118 TGTTTGAGGATGTATGTATTTGG - Intronic
912702202 1:111886830-111886852 TGGTCAAGCATATATGTGTTGGG - Intronic
913446439 1:118955402-118955424 TGCTTTGGGATATGTGAGATGGG - Intronic
913998271 1:143669558-143669580 TGTTTTTGCATATATCTGTTTGG - Intergenic
917452923 1:175162097-175162119 AGCTTTAAGATATATGTGGAGGG - Intronic
918153997 1:181826849-181826871 TCCTTTGGGATATCTGTCTTTGG - Intergenic
918442731 1:184584187-184584209 TACTTTGGGATTTGTGTGTTGGG - Intronic
918450299 1:184651087-184651109 TGCTTTAGGATTTCAGTGTAAGG - Intergenic
919149622 1:193679079-193679101 TGGTTTAGTTTATGTGTGTTAGG - Intergenic
921357681 1:214301930-214301952 TTCTTAAGTATATATGTCTTTGG - Intronic
921531984 1:216294783-216294805 TGTTTTAGTATTTATGTCTTTGG + Intronic
922420024 1:225453305-225453327 TGCTTAGGAAAATATGTGTTTGG + Intergenic
923135312 1:231112007-231112029 TGCTTTAGAAAATCTTTGTTTGG - Intergenic
924375756 1:243406747-243406769 TGCTGGAGGATATATGTTGTGGG - Intronic
1062884523 10:1006135-1006157 TGCTTTAGGGTAAAGTTGTTTGG - Intronic
1064367902 10:14724814-14724836 TGCTTTAGGACCTAGGTGTTGGG - Intronic
1066536388 10:36396931-36396953 TGTTTTAGAATCTATGTCTTCGG + Intergenic
1067856479 10:49797895-49797917 TCCTTTATCAGATATGTGTTTGG - Intergenic
1068272750 10:54750856-54750878 TGCTTAATTATATTTGTGTTTGG - Intronic
1070271554 10:74961440-74961462 TTCTTTAGGATCTATTTGTCTGG + Intronic
1071329053 10:84542694-84542716 TGCTTTAGAATACCTGTGCTGGG - Intergenic
1072469153 10:95695608-95695630 AGCTATGGGAGATATGTGTTTGG + Intergenic
1073277692 10:102326688-102326710 TGGTTTTGTATATATGTGTGGGG - Intronic
1075703983 10:124487961-124487983 TTCTTCAGGACATATGTGTGGGG + Intronic
1081292212 11:41340575-41340597 GGCTATAGCATTTATGTGTTTGG + Intronic
1082683544 11:56209724-56209746 TACTTTATGATATGTGTATTTGG - Intergenic
1084064674 11:66696953-66696975 TGCTTGAGGATTTCTGTGTCTGG + Intronic
1084300618 11:68248764-68248786 TGATTGAGTATATATCTGTTAGG - Intergenic
1088122351 11:106385281-106385303 TGCTTTATGTAATTTGTGTTAGG + Intergenic
1089887901 11:121846249-121846271 ATCTTTAGGCGATATGTGTTGGG + Intergenic
1091931396 12:4398369-4398391 TCATTTAGTATATATGTATTGGG + Intergenic
1091952739 12:4608466-4608488 TCCTTTAGGATAAAAGGGTTTGG + Intronic
1092684167 12:11022998-11023020 TACTATATGATATATGTATTGGG - Intronic
1092686597 12:11055770-11055792 TGATGTAGGATCTATGTATTAGG - Intronic
1092688467 12:11078676-11078698 TACTGTATGATATATGTATTTGG - Intronic
1092690038 12:11098585-11098607 TGCTATATGATCTATGTATTGGG - Intronic
1094194818 12:27737402-27737424 TGCTTTAGGAAAACTGTTTTTGG - Intronic
1094253411 12:28393547-28393569 TGTTTTAGGCTATATGGTTTAGG - Intronic
1094478119 12:30857741-30857763 TACTTTAGGGTACATGTTTTAGG - Intergenic
1096483003 12:51955069-51955091 TGCTTTAGGCTTTATTGGTTTGG + Intronic
1097557464 12:61156947-61156969 GGCTTTAGGAAAAATGGGTTCGG + Intergenic
1098237969 12:68436434-68436456 TGCTTTAGGCTAACAGTGTTTGG + Intergenic
1098556398 12:71823670-71823692 TGCTTGAGGATAACTGTGTAAGG - Intergenic
1099218787 12:79887049-79887071 TGCATTACGTTATATGTGGTAGG - Intronic
1099623952 12:85043747-85043769 AGTTTTATGATATATGTGTGGGG - Intronic
1100921926 12:99497948-99497970 TGCTTTAGGTTAACTGTGTTAGG - Intronic
1101664487 12:106798792-106798814 AGCTTTTTGATAAATGTGTTGGG - Intronic
1102158360 12:110748308-110748330 TTCTTTATGATTTAGGTGTTAGG - Intergenic
1102696491 12:114803756-114803778 TGCTGCAGGCTAAATGTGTTTGG + Intergenic
1106375243 13:29180353-29180375 TTCTTTATGATACTTGTGTTTGG - Intronic
1106980842 13:35277707-35277729 TCCTTTAGAATATGTGTATTTGG - Intronic
1107552025 13:41486014-41486036 TTCTTTGGGTTATATCTGTTTGG + Intergenic
1109323491 13:60838382-60838404 TGGTTTAGAATAAATGTGATGGG - Intergenic
1110303537 13:73957236-73957258 TGCTTCAGAATATATCTGCTGGG + Intronic
1110351959 13:74519508-74519530 AACTTTAGGATGTAGGTGTTGGG - Intergenic
1110922569 13:81106874-81106896 TGTGTTAGGATATATGTGTGAGG - Intergenic
1111082328 13:83327799-83327821 TCTTTTAGGATAAATGTGTAAGG - Intergenic
1112476381 13:99734675-99734697 TGCGTTAGAATATATGTCTATGG - Intronic
1113327240 13:109293987-109294009 TGCGTTAGGGTATATGTGTAGGG - Intergenic
1114413359 14:22520667-22520689 TGCTCCTGAATATATGTGTTGGG + Intergenic
1115683216 14:35765336-35765358 AACTTTAAGATATATTTGTTAGG + Intronic
1116278228 14:42865407-42865429 TGTTTTAGCATGTATGTGTGGGG + Intergenic
1117145654 14:52834766-52834788 TACTTTAGAAAATATGTCTTTGG + Intergenic
1117864062 14:60126920-60126942 TGCTTTAGGAGATAAGCATTTGG - Intronic
1118034715 14:61854050-61854072 TGCTTTAGCCTATATATATTAGG + Intergenic
1120636456 14:86957617-86957639 TGTTTAAGAATATATGTGTGGGG + Intergenic
1123054610 14:105563237-105563259 TGTGTGAGGATATAAGTGTTAGG + Intergenic
1126344324 15:47676740-47676762 TGTTTCAAGATCTATGTGTTGGG - Intronic
1133863385 16:9618169-9618191 TGTTTTAGGATACATTTGTTTGG - Intergenic
1134611211 16:15609840-15609862 TGTTTTAGGTTGTGTGTGTTTGG - Intronic
1139038058 16:62971732-62971754 TGCTTTAGCATATTTTAGTTTGG + Intergenic
1140656542 16:77146422-77146444 TGAATAAGGACATATGTGTTAGG - Intergenic
1140767224 16:78171453-78171475 TCTTTTATGATATATGTGTTGGG + Intronic
1143233370 17:5376485-5376507 TGCTTTAGGATATAATTGGAAGG + Intronic
1143398224 17:6620036-6620058 TGCTTATGGATGTATATGTTAGG - Intronic
1149954257 17:61029427-61029449 TAGTTTAGGATATTTGAGTTTGG + Intronic
1156705883 18:39881617-39881639 TCCTTTACCAGATATGTGTTTGG - Intergenic
1157363711 18:47044007-47044029 TGTTTCATGATATGTGTGTTAGG - Intronic
1158616107 18:58988570-58988592 TGCTTTTGTTTTTATGTGTTTGG + Intergenic
1167416946 19:49379192-49379214 TATTTTATGATATATGTTTTTGG + Intergenic
926558606 2:14390083-14390105 TTCTTTAGTTTTTATGTGTTTGG - Intergenic
929375587 2:41282967-41282989 TGTTTTAAAATAAATGTGTTTGG - Intergenic
933210735 2:79565535-79565557 TGATTTAGGATATTGGTGGTAGG + Intronic
934740297 2:96716083-96716105 TGCTTTAGAAGATGTATGTTTGG - Intronic
935057443 2:99579840-99579862 TGTTTTATGATCCATGTGTTTGG - Intronic
935108399 2:100068473-100068495 TACTTTAGGATAATTGTGTCAGG - Intronic
935321336 2:101892240-101892262 TGATTTAGTTTATATGTTTTTGG + Intronic
935579340 2:104743288-104743310 TGCTTCACAATATATGAGTTGGG - Intergenic
935861700 2:107338023-107338045 CACTTTAGAATATAAGTGTTTGG - Intergenic
937385151 2:121423639-121423661 TGCTGTAACATATTTGTGTTTGG - Intronic
939684214 2:145177759-145177781 TGCTTTAGGGGATATGTCTGTGG - Intergenic
940179884 2:150920111-150920133 TGCCTGCGGATATATGTGGTTGG - Intergenic
940388080 2:153097534-153097556 ACCTTTAAGAAATATGTGTTAGG - Intergenic
940959256 2:159764805-159764827 TGATTTGGGAAATATGGGTTGGG + Intronic
942063459 2:172248692-172248714 TGCTTTAGGTGATGTTTGTTGGG + Intergenic
942480575 2:176384054-176384076 TGCTTTAGGACAAGTGTTTTAGG + Intergenic
943358270 2:186886468-186886490 TGCATTAGGACTTTTGTGTTTGG - Intergenic
944817851 2:203397590-203397612 TGCTATAAAATGTATGTGTTTGG + Intronic
945769709 2:214027685-214027707 TGTTTTAGTATATAAGTTTTAGG + Intronic
947232003 2:227897400-227897422 TGCTTTAGGATATATGTGTTGGG + Intronic
1169431807 20:5542961-5542983 AGCTTTATGTTATGTGTGTTAGG - Intergenic
1169563128 20:6823552-6823574 TGCTTTAAAATATGTGTCTTTGG + Intergenic
1172294335 20:33797882-33797904 TCCTTTAAAAAATATGTGTTTGG - Intergenic
1173082718 20:39884789-39884811 TGTTTTTGGATATAAGTTTTAGG + Intergenic
1173215668 20:41080496-41080518 TGCTTTAAGTTATCTGTGGTAGG - Intronic
1177510002 21:22074362-22074384 TTCTTTAGCATATATGTGTCTGG + Intergenic
1178713273 21:34939734-34939756 TGTTTTAGGGAAGATGTGTTAGG + Intronic
1179068248 21:38046689-38046711 TGCTTTAGAAAAAATGTTTTGGG + Intronic
1181488355 22:23245648-23245670 TGCTTTCGGAGATGTGTGGTTGG - Intronic
1182386516 22:29946973-29946995 TGCTTTAGAATATAGGGTTTAGG + Intronic
1182837806 22:33358614-33358636 TGCTTTAGGATTTTTCTTTTAGG + Intronic
950201617 3:11048462-11048484 TGCTTTGAGATATATGGGGTGGG - Intergenic
950627082 3:14255130-14255152 TGTTTTGGGATGTTTGTGTTGGG + Intergenic
950797856 3:15525158-15525180 TCATTTATCATATATGTGTTTGG - Intergenic
953773742 3:45798319-45798341 GGCCTTAGGATAGGTGTGTTTGG + Intergenic
954930068 3:54273461-54273483 TGGTTTAGTTTATATGTGATTGG - Intronic
955124778 3:56100318-56100340 TGCTTTTTGATAAAGGTGTTGGG - Intronic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
957104170 3:75865772-75865794 TTCTTTTGGATATGTGTGTGAGG - Intergenic
957140059 3:76342624-76342646 TGTTATAGGATATATTTGTAAGG - Intronic
960131967 3:114066587-114066609 TGCTCTAGGGTATATGTGCAAGG + Intronic
960133951 3:114087285-114087307 TGCTGTATGTTTTATGTGTTGGG + Exonic
962069194 3:132015530-132015552 TCGTATATGATATATGTGTTGGG - Intronic
964305664 3:155336669-155336691 GGCTTTAGGAGTTATGTGCTAGG + Intergenic
966486835 3:180480359-180480381 TGCACTATGATATCTGTGTTTGG - Intergenic
967046941 3:185746151-185746173 TGAATTTGTATATATGTGTTGGG - Intronic
971915513 4:32865863-32865885 AGCCTTAGGATCTCTGTGTTAGG - Intergenic
973529132 4:51817977-51817999 TGCTTAGGGATATATGGATTTGG + Intergenic
974301188 4:60068900-60068922 TTCTTTGGGTTATATCTGTTTGG - Intergenic
974907051 4:68071103-68071125 TACTTTAGGATATATGATTGTGG + Intronic
975140965 4:70918061-70918083 TTCTTTAGGATATATTTTTGTGG - Intronic
975200955 4:71588895-71588917 TTCTAAAGGATATATGTGGTGGG + Intergenic
976316558 4:83664835-83664857 TTCTTTAAAAAATATGTGTTTGG - Intergenic
977084787 4:92579469-92579491 TGCTTTTGGAATAATGTGTTAGG - Intronic
977568154 4:98602856-98602878 TGCTGTATGTCATATGTGTTAGG - Intronic
979191558 4:117865721-117865743 TCCTTTAAGATATGTGTGTGAGG + Intergenic
979551192 4:121992858-121992880 AGCTTTAGAATATATTTGTTTGG - Intergenic
980170680 4:129286042-129286064 TGCTTTAAGAAAAATGTGGTTGG + Intergenic
981074608 4:140578664-140578686 TGTTTTAGGAGATATGAGATAGG + Intergenic
981894499 4:149782050-149782072 TGCTTGAGCAAATAAGTGTTAGG - Intergenic
982307991 4:153953670-153953692 CTTTTTAGGATGTATGTGTTAGG + Intergenic
982664168 4:158241014-158241036 TTCTTTAGCATAAATCTGTTAGG - Intronic
983951341 4:173646360-173646382 TGCTTTAGGAAATTTGTGTTGGG + Intergenic
984302575 4:177941459-177941481 TGCTTTTGGACATTTTTGTTTGG + Intronic
984315171 4:178120310-178120332 ACCTTTAGGCTATATGTGTAAGG + Intergenic
984763436 4:183382063-183382085 TGCTTTAGGATCTGTGTCATTGG + Intergenic
985171109 4:187151006-187151028 TGTTTTAGAATATTGGTGTTTGG - Intergenic
1202751481 4_GL000008v2_random:7931-7953 TTCTTTTGGATATGTGTGTGAGG + Intergenic
988182432 5:27814900-27814922 TGCTTTGGAATATATTTCTTTGG + Intergenic
992176842 5:74157480-74157502 TGCTTGAGCATGGATGTGTTGGG - Intergenic
992606938 5:78467109-78467131 GGCTTTTGTATATATGAGTTAGG + Intronic
993143407 5:84063267-84063289 TGCTTTATGATAAATGGCTTAGG + Intronic
994724940 5:103423963-103423985 TAATTTAGGATGTATTTGTTGGG - Intergenic
995499399 5:112787317-112787339 TGCTTTTAGATATATATGCTAGG - Intronic
996183619 5:120450810-120450832 TGCTTTAGGAAAAATGTATTAGG + Intergenic
996266939 5:121553119-121553141 TGGTTTAGTTTCTATGTGTTGGG - Intergenic
996513422 5:124343296-124343318 TTCCTTAGAATACATGTGTTTGG - Intergenic
997728563 5:136144655-136144677 TACTTTAGGATAGGTATGTTAGG + Intronic
997795104 5:136801469-136801491 TGAATTACGATATGTGTGTTTGG - Intergenic
998791413 5:145769575-145769597 TGCTTTAGAAAATTTTTGTTTGG - Intronic
1000159684 5:158585282-158585304 TTCTTTAGGTTAAATCTGTTTGG + Intergenic
1000816691 5:165931522-165931544 TGCTTTAAGCCATATGTTTTAGG - Intergenic
1001111661 5:168901676-168901698 TGCTTTAGGCTATATGACTTTGG - Intronic
1001155229 5:169266902-169266924 TGCTTAAGGTAATATGTGTTAGG - Intronic
1003347999 6:5288577-5288599 TGGTTTTGAATATATGTGGTTGG + Intronic
1003445992 6:6184853-6184875 GGCTTTTGTATATGTGTGTTGGG + Intronic
1003822066 6:9909571-9909593 TTCTTTAGTATATTTGTTTTAGG + Intronic
1005321940 6:24664095-24664117 TGTCTTAGGTTTTATGTGTTAGG + Intronic
1006065725 6:31461297-31461319 TGCTATAGGAGATCTGTGGTTGG + Intergenic
1006992201 6:38224817-38224839 TGTTTCAGAATATGTGTGTTAGG + Intronic
1007006135 6:38364712-38364734 TGCTTTAGGTTACCTGGGTTTGG - Intronic
1007284222 6:40736279-40736301 TCCTTTAGGATAGCTGAGTTAGG - Intergenic
1008022789 6:46600020-46600042 GGTTTTAGGAGATCTGTGTTAGG - Intronic
1008116255 6:47553807-47553829 TTCATGAGGATATATCTGTTTGG + Intronic
1008484637 6:52022765-52022787 TGCTTTAAAATATATGTGTGTGG + Intronic
1009422765 6:63482258-63482280 TGCTCTATGATCTAGGTGTTGGG - Intergenic
1009444779 6:63728987-63729009 GGCTTTAGGTGATAAGTGTTCGG + Intronic
1009535339 6:64875271-64875293 TGCTTTGGGACATAGGTATTAGG + Intronic
1009992395 6:70860047-70860069 TGCTTTAAGAAATATTTGTATGG + Exonic
1010106724 6:72178943-72178965 TGCTTTAGTAAATATGTGCATGG + Intronic
1010284916 6:74065661-74065683 TGCTTTAGGATTTAAGTGGCAGG - Intergenic
1010409932 6:75549781-75549803 TACTTTAGGATAGATGCCTTTGG - Intergenic
1010976881 6:82325385-82325407 TGCTTTAGGAAAGTTGAGTTGGG + Intergenic
1012151190 6:95756779-95756801 TGCTTTAGGAAATATGTCCCAGG + Intergenic
1012808026 6:103919976-103919998 TGCTTTAGTATATCTGGATTTGG - Intergenic
1014557412 6:122851229-122851251 GGCATTTAGATATATGTGTTTGG + Intergenic
1014701116 6:124689359-124689381 TCCTTTATCATATATGTTTTTGG + Intronic
1014967368 6:127771896-127771918 TGCCTTATGATATATGTATATGG - Intronic
1015508692 6:134016037-134016059 AGTTTTAGGATATTTGGGTTGGG + Intronic
1016637963 6:146316561-146316583 TTCTGTAGGATATAAGTCTTTGG + Intronic
1017055757 6:150434306-150434328 TACTTGAGGATCTATGTTTTAGG - Intergenic
1019792542 7:3026110-3026132 TGTTTTTGGAAACATGTGTTTGG - Intronic
1019955787 7:4413438-4413460 TGTGTTGGGAAATATGTGTTGGG - Intergenic
1020464414 7:8460967-8460989 TACTTTTGGCTATTTGTGTTTGG + Intronic
1027476266 7:78635504-78635526 TTCTTTAGCAAATATGTATTGGG - Intronic
1030446760 7:109655258-109655280 TCCTTTAGAAGAAATGTGTTTGG - Intergenic
1030802935 7:113876040-113876062 TACTTTAGGATGTTTGTATTTGG + Intergenic
1031367641 7:120922771-120922793 TGCTTTTGGCTATATGCTTTTGG + Intergenic
1032451336 7:132034505-132034527 TTCTTTAGAATATATTTGTGGGG + Intergenic
1033524625 7:142198269-142198291 TGCCTTAGGAAATATGTGCTTGG - Intronic
1037203302 8:16284204-16284226 TGTTTTAGGGTAAATGTCTTGGG - Intronic
1037722695 8:21458565-21458587 GGCTTTAGGAGCTATGTGTCAGG - Intergenic
1038384847 8:27133955-27133977 TGCTTTAGCATGGATTTGTTTGG + Intergenic
1038963888 8:32549920-32549942 TGCTTCATGAAATGTGTGTTGGG - Intronic
1042322420 8:67490827-67490849 TGCTTTCGGATTTACGTGGTTGG + Intronic
1042325758 8:67526144-67526166 TGCTTTAGGACATTTGTGGAGGG + Intronic
1042957001 8:74261480-74261502 TGCTTTAGATTATTTGTGTATGG + Intronic
1043945794 8:86251164-86251186 TTCTTTAGGTTAAATCTGTTTGG + Intronic
1045391803 8:101722465-101722487 TTCTTTAGAATATATCTCTTTGG + Intronic
1046311817 8:112447582-112447604 TCCTTTTGGATATTTGTTTTAGG + Intronic
1047880267 8:129185274-129185296 TGCTAAACGATATATGTGATTGG + Intergenic
1047882584 8:129212685-129212707 GGCTTTGGGATGTGTGTGTTGGG + Intergenic
1048438149 8:134436862-134436884 TGATTTAGGTTGTATGTGTGTGG - Intergenic
1051694318 9:19751775-19751797 TTCTTTAGCAAATATGTGTCTGG + Intronic
1053193771 9:36098587-36098609 TGCTTCAGGATAAAATTGTTAGG - Intronic
1058348168 9:103989821-103989843 TTCTTTAGGATATATGTTGTTGG + Intergenic
1059268287 9:113056367-113056389 GGCTTTAGGATATCAGTATTAGG - Intronic
1059660378 9:116394248-116394270 TGATTCAGCATATATGTATTTGG + Intronic
1203718942 Un_KI270742v1:185620-185642 TTCTTTTGGATATGTGTGTGAGG - Intergenic
1203653176 Un_KI270751v1:149295-149317 TTCTTTTGGATATGTGTGTGAGG - Intergenic
1185569812 X:1126051-1126073 TACTTTAGTATATATGTATATGG - Intergenic
1186239268 X:7548758-7548780 TTTTCTAGGCTATATGTGTTAGG - Intergenic
1186753386 X:12644680-12644702 TGCTTAAGGAGACTTGTGTTGGG - Intronic
1189299209 X:39940573-39940595 TGCTGTGGGTTATTTGTGTTTGG + Intergenic
1192301600 X:69909650-69909672 TTCTTTTGTATGTATGTGTTTGG + Intronic
1192469608 X:71386461-71386483 TGTTTTATGATTTATTTGTTTGG + Intronic
1194528361 X:95010336-95010358 TGCTTAAGAATATATTTGTCAGG + Intergenic
1194637359 X:96362381-96362403 TGCTTTAGAATATCAGTGTCAGG - Intergenic
1194659764 X:96617656-96617678 TGCTTTTTGATAGATGAGTTGGG - Intergenic
1194682067 X:96866387-96866409 TGCTATATGAAATATGTCTTTGG - Intronic
1194943961 X:100046415-100046437 GGCTTTAGAATATGTGTTTTTGG - Intergenic
1196120342 X:112043439-112043461 TACTTTTGGAAATACGTGTTAGG - Intronic
1197670913 X:129276087-129276109 TGCTTTTGGGAATTTGTGTTTGG - Intergenic
1197698799 X:129580647-129580669 TGCTTGGGGACATATCTGTTGGG + Intronic
1197897379 X:131329895-131329917 TGCTTTAGGAAAAAGGGGTTTGG + Intronic
1198503206 X:137273991-137274013 TCCTTTACAATATATATGTTGGG - Intergenic
1199256126 X:145720801-145720823 TGCTTTAGGATACATTTATGGGG - Intergenic
1199682210 X:150234154-150234176 TTCTTTAAGATATATGTCTCTGG - Intergenic
1201173096 Y:11290462-11290484 TTCTTTTGGATATGTGTGTGAGG - Intergenic