ID: 947232652

View in Genome Browser
Species Human (GRCh38)
Location 2:227903526-227903548
Sequence GCAAGTGACCAGAGGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947232642_947232652 29 Left 947232642 2:227903474-227903496 CCCGCTGGTCTTTCAGCCATCCT 0: 1
1: 0
2: 2
3: 12
4: 198
Right 947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG 0: 1
1: 0
2: 0
3: 21
4: 267
947232644_947232652 13 Left 947232644 2:227903490-227903512 CCATCCTGTATCACAAAAGTCTG 0: 1
1: 0
2: 0
3: 17
4: 194
Right 947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG 0: 1
1: 0
2: 0
3: 21
4: 267
947232645_947232652 9 Left 947232645 2:227903494-227903516 CCTGTATCACAAAAGTCTGAAAT 0: 1
1: 0
2: 0
3: 19
4: 255
Right 947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG 0: 1
1: 0
2: 0
3: 21
4: 267
947232643_947232652 28 Left 947232643 2:227903475-227903497 CCGCTGGTCTTTCAGCCATCCTG 0: 1
1: 0
2: 2
3: 33
4: 221
Right 947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG 0: 1
1: 0
2: 0
3: 21
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947232652 Original CRISPR GCAAGTGACCAGAGGGGAAA AGG Intronic
901067591 1:6501819-6501841 GCCTGGGACCAGTGGGGAAAGGG - Intronic
903195003 1:21679370-21679392 AGAAATGACCAGAGGGGAAGAGG - Exonic
903704568 1:25275890-25275912 TCAAGTGAACAAAAGGGAAAAGG - Intronic
904680111 1:32223055-32223077 GCAAGAGACCACTGTGGAAAGGG + Intronic
905224729 1:36471779-36471801 ACAAGGGAACAGAGGGAAAAGGG - Intronic
905870253 1:41399454-41399476 GGAAGTGAGCAGAGGGGCACGGG - Intergenic
910486414 1:87719659-87719681 GCAACTGTGCAGAGGGGAGATGG + Intergenic
910988018 1:93025514-93025536 GCAAATTAACAGAGTGGAAAGGG - Intergenic
911053509 1:93692223-93692245 GGAAGGAACCAGAGAGGAAAGGG - Intronic
911169362 1:94755122-94755144 GAAAGTCAGCAGAGGGCAAATGG - Intergenic
912462774 1:109847698-109847720 GAAACTTACCAGAGGGGAAGGGG - Intergenic
912631121 1:111247626-111247648 GCAAGTGAACTGAGGAGAACAGG - Intergenic
912969394 1:114266437-114266459 GCTAGTGACTAGAGGGAAAATGG + Intergenic
915119982 1:153623889-153623911 GCAAGTTACTATAGGTGAAATGG + Intronic
917748064 1:178029758-178029780 GCCAGGGACCTGGGGGGAAATGG - Intergenic
917930180 1:179817471-179817493 GCAAGGGAAGAGAGGGGAATTGG + Intergenic
918423228 1:184385403-184385425 ACAAGTCACCAGTGGTGAAAGGG + Intergenic
918644543 1:186888377-186888399 GGAAGGCACCAGATGGGAAAAGG - Intronic
918753306 1:188301769-188301791 TCGAATGACCAAAGGGGAAAAGG - Intergenic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
922879548 1:228970350-228970372 GCAGAAGAGCAGAGGGGAAAAGG - Intergenic
923166472 1:231368676-231368698 GCCAGTGGACACAGGGGAAAAGG + Intronic
924706545 1:246507168-246507190 GCAACCGCCAAGAGGGGAAACGG - Exonic
1063051685 10:2456407-2456429 GCAGGTGAACAGAGAGTAAAAGG + Intergenic
1063539180 10:6914783-6914805 GCAAGTGTGGAGATGGGAAAGGG + Intergenic
1063762205 10:9092749-9092771 GAAAGAGCCCACAGGGGAAATGG - Intergenic
1064868543 10:19910536-19910558 TCAGGTGACCAAAAGGGAAAGGG - Intronic
1069650629 10:70044779-70044801 GCAAGTTTCCAGAGGGAAGAAGG + Intergenic
1071164347 10:82787078-82787100 GCATGTGTCTAGAGGGAAAATGG - Intronic
1072233045 10:93429195-93429217 GCAAGAGAGAAGAGGGGGAAGGG - Intronic
1073209248 10:101785399-101785421 ACAACTGACCTGAGGGCAAATGG + Exonic
1073622937 10:105067553-105067575 GAAAGTCACCTGAGTGGAAAAGG - Intronic
1074268510 10:111929377-111929399 GTCAGGGACCAGAGGGCAAAAGG + Intergenic
1074622138 10:115136889-115136911 GTAAGTCACCTGAGGGAAAAAGG + Intronic
1075763675 10:124876046-124876068 GCCAGTGAGCTGAGGGGAACTGG - Intergenic
1075816872 10:125271434-125271456 ACAAGTGTCCAAAGGGGAGAAGG + Intergenic
1076125912 10:127973855-127973877 GCATGTGAGAAGTGGGGAAAAGG - Intronic
1076493782 10:130883448-130883470 ACTAGAGACCAGAGAGGAAAAGG + Intergenic
1076979898 11:198701-198723 GCAGGTGCCCAGAGGGTGAAGGG - Intronic
1077489643 11:2854949-2854971 ACAGGTGACCAGAGAGGGAAGGG + Intergenic
1077966129 11:7135466-7135488 GCAAGGCACCAAAGGGAAAAGGG - Intergenic
1078259156 11:9688442-9688464 GCAAGGGCCCAGGGGAGAAAGGG + Intronic
1078441653 11:11373208-11373230 GTGAGTGACCAGAGGGTAAGGGG + Intronic
1080925849 11:36755118-36755140 ACAAGTGCCCAGAAGAGAAAGGG - Intergenic
1081088938 11:38837491-38837513 GCAAATGAAAAGAGAGGAAAGGG + Intergenic
1081373436 11:42331917-42331939 GCAAATCAGAAGAGGGGAAAGGG - Intergenic
1082212491 11:49522094-49522116 GCAAATGAAAAGAGGGGAAAGGG + Intergenic
1082796487 11:57381531-57381553 GGAAGAAACAAGAGGGGAAAGGG + Intergenic
1084973146 11:72781988-72782010 GCAAGTCCCCAGCGGGGACAGGG + Intronic
1086318475 11:85618602-85618624 GCAAGGGACTAGTGGGGCAAGGG + Intronic
1086637103 11:89102403-89102425 GCAAATGAAAAGAGGGGAAAGGG - Intergenic
1088158717 11:106842051-106842073 GCAGGTGACCAGAGTGGGAGAGG + Intronic
1088684797 11:112275569-112275591 AGAAGTGAGTAGAGGGGAAAAGG + Intergenic
1089168630 11:116497391-116497413 GCAAGAGCCCAGAGGGTAATAGG + Intergenic
1091655688 12:2345192-2345214 CCAAGTGCGCAGAGGTGAAAGGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092228703 12:6765471-6765493 GAAAGAGACCAGAGGTGGAAGGG + Intronic
1092868929 12:12788206-12788228 GTAAGTAAGCTGAGGGGAAAGGG - Exonic
1095561745 12:43574141-43574163 CCAAGTGAATAGAGAGGAAAGGG + Intergenic
1095743747 12:45634780-45634802 GCAAGAGCCCAGAGAGAAAAGGG - Intergenic
1096690764 12:53320311-53320333 GCAAGTTACTAGAGATGAAATGG + Intronic
1100460982 12:94799014-94799036 GCAAGTGTCCTGAGGTGGAAAGG - Intergenic
1102546363 12:113659573-113659595 GCAAGTGTCCAGAGGTGGGAGGG + Intergenic
1104689369 12:130813781-130813803 TGAAGTGACCAGAAGGGAAGGGG + Intronic
1104798589 12:131537271-131537293 TCTAGGGAACAGAGGGGAAATGG + Intergenic
1107655608 13:42589728-42589750 GCAAGTGCAGAGAGGGCAAAGGG + Intronic
1108890674 13:55254375-55254397 CCAAGTGAGAATAGGGGAAAAGG - Intergenic
1109172600 13:59115205-59115227 GGAAGTAACCAAATGGGAAATGG - Intergenic
1109589282 13:64456543-64456565 GCAAATTACCAGAGGAAAAAAGG + Intergenic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1117289739 14:54320861-54320883 GCAGGAGACCAGAGGGCAAGAGG + Intergenic
1117407225 14:55416076-55416098 GGAAGTGAGGAGAGGGGAATGGG + Intronic
1117819803 14:59636346-59636368 GCAAGGGAGCAGAGGGCAAGAGG - Intronic
1118731594 14:68670626-68670648 GCAAGTGGCCAGGAGGGCAAGGG - Intronic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1119152351 14:72373195-72373217 GCAAGTGACCAGAAAGCTAAAGG + Intronic
1120295502 14:82635074-82635096 GTAAGTGACCCAAGGAGAAATGG - Intergenic
1120489464 14:85158367-85158389 CCATGTGACCAGAGGGGGAGAGG + Intergenic
1121078664 14:91090122-91090144 GCCAGTGAGGAGAGGGGAATGGG - Intronic
1121305541 14:92904231-92904253 GGAAGAGGCCAGAGGGGAAGGGG + Intergenic
1122111830 14:99508680-99508702 GCAAGTGTACAGAGAGGGAATGG + Exonic
1122347704 14:101070786-101070808 GTGAGTGACCAGAGGGGGACTGG + Intergenic
1123072864 14:105650526-105650548 GGAAGTGTCCAGCGTGGAAAAGG + Intergenic
1123833391 15:24164613-24164635 GCAAGTCAGCAGTGGAGAAAGGG + Intergenic
1123840121 15:24239692-24239714 GCAAGTCAGCAGTGGAGAAAGGG + Intergenic
1123853064 15:24380207-24380229 GCAAGTCAGCAGTGGAGAAAGGG + Intergenic
1123869020 15:24552775-24552797 GCAAGTCAGCAGAGGAGAAAGGG + Intergenic
1126043837 15:44619577-44619599 GCAAGTGACAAGAGCTGAGATGG - Intronic
1126405471 15:48318302-48318324 GCAGGAGACCAGAGGGAGAAGGG - Intergenic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1128690455 15:69720886-69720908 GAATTTGAACAGAGGGGAAAAGG - Intergenic
1128780764 15:70357324-70357346 GGAAATGGCCAGAGGGGAACAGG - Intergenic
1129348518 15:74939727-74939749 GCAAGAGACAAGAGGGCAGAAGG - Intergenic
1129691575 15:77716933-77716955 GCAAGTGAGAATAAGGGAAATGG - Intronic
1133805819 16:9125416-9125438 CCAAGTCACCAGTGGAGAAATGG - Intergenic
1134044131 16:11088990-11089012 GCAGGTGGCCTGGGGGGAAAGGG - Intronic
1134634690 16:15783372-15783394 GAAAGTGTCTAGAGGGGACAAGG + Intronic
1135646874 16:24170807-24170829 GCAGGTGCCCAGAGAGGGAAAGG - Intronic
1136054503 16:27678425-27678447 GGAAGAGGCCAGAAGGGAAAAGG - Intronic
1136774810 16:32866294-32866316 GCCAGTGATCAGAGGGGACCTGG + Intergenic
1137350108 16:47706005-47706027 CCAACCGAGCAGAGGGGAAAGGG - Intergenic
1138495565 16:57407023-57407045 ACAAGTGGGCAGAGAGGAAATGG + Intronic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141175771 16:81718078-81718100 CTGAGTCACCAGAGGGGAAAAGG + Intergenic
1142899686 17:3004321-3004343 GCCAGAGTCCGGAGGGGAAACGG - Intronic
1142941464 17:3383040-3383062 GAGAGTGACCAGAATGGAAAAGG + Intergenic
1144270223 17:13608074-13608096 CCAAGAGACCAGAGAGGACATGG + Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146709243 17:35026567-35026589 GCAAGGGAGGAAAGGGGAAAAGG + Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148798584 17:50209576-50209598 CCATGTGGCCAGAGGGGGAAGGG + Intergenic
1148830111 17:50425843-50425865 GCACGTGACCCGAGGGGGCAGGG + Intergenic
1149659748 17:58328006-58328028 GCAAGAGCTCAGAGGGGAGAGGG - Exonic
1150210560 17:63439007-63439029 GCAAGGGGCCAGTGGGGAACCGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152630730 17:81409683-81409705 GCCACTGACCAGAGGGAAATCGG + Intronic
1153473611 18:5472907-5472929 GTAAGGGACCAGAGAGGATAAGG - Intronic
1156033910 18:32744890-32744912 GCCAGTGAACAGTGGGCAAACGG + Intronic
1158374742 18:56850174-56850196 GAAAGTGACTAGAAGGGGAAGGG - Intronic
1158416838 18:57256349-57256371 GGTAGTGAACAGATGGGAAAGGG - Intergenic
1158448281 18:57540215-57540237 GCAAGTGACCAAAAAGTAAATGG + Intergenic
1159005286 18:63005168-63005190 GTAAAGGACCAGAGGAGAAATGG + Intergenic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1162540687 19:11294159-11294181 GCAAATGAGCAGTGGGAAAACGG - Intergenic
1165484306 19:36086216-36086238 GCAAGTGACCAGAGTAGGGAAGG + Intronic
1165833698 19:38742359-38742381 CCAAGTCACCATGGGGGAAACGG + Intronic
1167331587 19:48859596-48859618 GGAGGTGAGCAGAGGGGAAGAGG - Exonic
1167861021 19:52284212-52284234 GGAAGAGACCACAGGGAAAAGGG - Intronic
925343626 2:3154085-3154107 GGAAGTAACCAGAGAAGAAATGG - Intergenic
925351502 2:3204085-3204107 GGCACTGACCAGAGGTGAAAGGG + Intronic
925740571 2:7002316-7002338 GCAAGGGATCAGAGGGGGCAGGG - Intronic
925918282 2:8622802-8622824 GGAAGAGACCAGAGGGGAACTGG - Intergenic
926544308 2:14220041-14220063 GGAAGCAAGCAGAGGGGAAAAGG + Intergenic
926942583 2:18153960-18153982 GCATGAGAGCAGATGGGAAAGGG + Intronic
927887853 2:26729519-26729541 TGAAGTGACCAGAGAGCAAAAGG + Exonic
930004880 2:46888726-46888748 GCAGCTGAGCAGACGGGAAAAGG - Intergenic
931148682 2:59548150-59548172 GCAGTTGACCACAGGGGTAATGG - Intergenic
934879187 2:97958652-97958674 GCAAGTGACCAGATTTGAAGGGG + Intronic
937929128 2:127191385-127191407 GCAAGAGGCCAGCGGTGAAATGG - Intronic
939643769 2:144671536-144671558 GCCAGTAACCAGTGAGGAAATGG - Intergenic
940379044 2:152992844-152992866 GAAAGAGTCCAGAGGAGAAATGG + Intergenic
946145574 2:217728135-217728157 GCACGTGAGCAGAGGAGATAAGG + Intronic
946193702 2:218021221-218021243 TCTAGAGACCAGAGGGGAAACGG + Intergenic
947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG + Intronic
947424655 2:229972533-229972555 GCAAGTGAACAGAGGGAGAGAGG + Intronic
1169650338 20:7859609-7859631 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1169650342 20:7859631-7859653 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1169650346 20:7859653-7859675 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1169650350 20:7859675-7859697 GAAAGTGAAAAGAGGGGAAGAGG + Intergenic
1170207578 20:13815237-13815259 TCAAGTGACCAGAGGTAAACTGG - Intronic
1170738662 20:19033319-19033341 ACAAGTGGTCACAGGGGAAAGGG - Intergenic
1172100073 20:32480022-32480044 ACGGGAGACCAGAGGGGAAATGG + Intronic
1172526981 20:35605862-35605884 ACAAGTTCCCAGACGGGAAATGG + Intergenic
1173192580 20:40887545-40887567 GCAGGAGACCAGAGAGGAAGGGG - Intergenic
1173533990 20:43794926-43794948 GAAAGAGGACAGAGGGGAAATGG - Intergenic
1173533998 20:43794955-43794977 GGAAGAGGACAGAGGGGAAATGG - Intergenic
1177131005 21:17255481-17255503 GAAAGTGACCAGAGAGCCAAAGG - Intergenic
1179047508 21:37859965-37859987 GCAAGGGACCAGCAGGGTAAAGG - Intronic
1180857777 22:19059193-19059215 ACAAGGGAGCAGAGGTGAAAAGG + Intronic
1181378314 22:22478527-22478549 GGAAGTTACCACAGGGAAAATGG - Intergenic
1182030968 22:27159174-27159196 GCGAGTGAACAGAGGGGTGAGGG + Intergenic
1182510645 22:30817517-30817539 GCAAGGGTGCAAAGGGGAAAGGG + Intronic
1183070727 22:35394252-35394274 GCAAGAAACCAGGGAGGAAAAGG - Intergenic
1184257481 22:43295430-43295452 TCAAGTGACAGGAGGGTAAATGG + Intronic
1184585652 22:45446292-45446314 GAAAGAGACCAGAGAGGACAGGG + Intergenic
949276140 3:2284049-2284071 GCATGTTAGCAGAGGGAAAAAGG + Intronic
949554811 3:5143704-5143726 CCAAGTCACCAGGGTGGAAATGG + Intronic
950164184 3:10781084-10781106 GCAAGAGATCAGAGGGCGAAGGG - Intergenic
951418237 3:22450948-22450970 GAATGTGACCAGTTGGGAAATGG + Intergenic
953211209 3:40876732-40876754 TAAAGTGACCACAGGGGCAAGGG + Intergenic
953463174 3:43097490-43097512 GCAGGTGAGCAAGGGGGAAAGGG + Intronic
953854639 3:46491845-46491867 GTAAGTTATCAGAGAGGAAATGG + Intergenic
954069083 3:48129842-48129864 GCAAGTGACCTGAGCGAGAATGG - Intergenic
954371516 3:50171635-50171657 GGAAGTGGCCAGAGAGGAAGTGG - Intronic
955471044 3:59286748-59286770 GGAAGTGAGGAGAAGGGAAAGGG - Intergenic
955693721 3:61615086-61615108 TCAAGTGTCCAGAGGGGACAGGG - Intronic
956176610 3:66478916-66478938 GCAAGAAACCAGAAGGAAAATGG - Intronic
961443606 3:126967406-126967428 CCCAGTGACCTGAGGGAAAACGG - Intergenic
962018957 3:131476745-131476767 GAAAGTGTACTGAGGGGAAATGG - Intronic
963085662 3:141434002-141434024 GAGAGTGAGCAGAGGGGAACTGG - Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
964833091 3:160907891-160907913 GCAAGAGATCAGAGGGTAAGAGG - Intronic
965935470 3:174104973-174104995 GCTAGTGACAAGAGTAGAAAAGG + Intronic
966253971 3:177897198-177897220 GCAACTGACTATAGGAGAAAGGG - Intergenic
966599137 3:181757858-181757880 CCCAGTGACCAGAGGAGCAAGGG + Intergenic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
969201167 4:5607512-5607534 CAAAGTGACCAGATGAGAAATGG - Intronic
969292290 4:6247779-6247801 ACAGGTGCCCAGAGGGGGAAAGG + Intergenic
969855593 4:9996642-9996664 TCAAATGCCCAAAGGGGAAAGGG - Intronic
970713793 4:18896272-18896294 GCGAGTGTCAAAAGGGGAAAGGG + Intergenic
971412085 4:26384885-26384907 GCAAGAGGCAAGAGGGGAGAGGG - Intronic
973643246 4:52924143-52924165 GCAAGAGACCATATGGAAAATGG - Intronic
975816050 4:78217854-78217876 GCAAGAGAGGAGAGGGGAAGGGG - Intronic
976856399 4:89609830-89609852 GTGAGTGACCAGAGGAGAAAGGG + Intergenic
978763350 4:112379344-112379366 GCAAGTGATCAGAGAGGCAGAGG + Intronic
982263173 4:153513649-153513671 GCTACAGACCAGATGGGAAATGG - Intronic
982598410 4:157414459-157414481 GCAAGTGACCATATGCTAAAGGG - Intergenic
983118642 4:163851815-163851837 GCACATGGCCACAGGGGAAATGG - Intronic
984189463 4:176588234-176588256 GCAAGTGAGTAGAGGAAAAAAGG + Intergenic
988298648 5:29394703-29394725 GGAGGTGACCTGAGGGGAAGTGG - Intergenic
990890042 5:60637962-60637984 GCAAGTGAAAAGAAGGGAAAGGG + Intronic
990951777 5:61305492-61305514 GTAAGTGGCAAGAGGGGAGAAGG + Intergenic
992869679 5:80993819-80993841 TCAAGAGATGAGAGGGGAAAGGG - Intronic
992930348 5:81636997-81637019 GGAAGTAAGAAGAGGGGAAATGG + Intronic
993039296 5:82794223-82794245 GCAACTCCCCAGAGGGCAAAGGG - Intergenic
995372966 5:111440163-111440185 GCAAGGGAACAAAGAGGAAATGG + Intronic
995405168 5:111786600-111786622 GAAAGTGACAAGAGTGGGAAAGG - Intronic
995783237 5:115800266-115800288 GCCAGTGAACAGAGTGGAAATGG + Intergenic
996601848 5:125273455-125273477 GCAAGTGCCCAGGGTGAAAAGGG - Intergenic
997265709 5:132494105-132494127 GAAAGTGACCAGTGGTGAAAAGG - Intergenic
997781344 5:136661840-136661862 GCATGTCACCAGAGGAGGAAGGG - Intergenic
998332830 5:141344690-141344712 GCAAGTTGCCAGAGTGGACAGGG - Exonic
998943865 5:147315763-147315785 AGAAGTTACCAGTGGGGAAAAGG + Intronic
999073113 5:148768811-148768833 GCAAGAGACAAGAGGAGAAATGG - Intergenic
999363615 5:151006800-151006822 GGAAGTGCCCAGGGTGGAAATGG - Intergenic
999938550 5:156515774-156515796 CCAAGTTTCCAGAGGGGAAGGGG + Intronic
1001527049 5:172436513-172436535 ACATGAGGCCAGAGGGGAAAGGG + Intronic
1003443480 6:6164668-6164690 GGAAGGGACAAGAGGGAAAAAGG - Intronic
1003742961 6:8964263-8964285 AGAAGTTACCAAAGGGGAAAAGG - Intergenic
1005943394 6:30578203-30578225 GTAAATGACCTGAGGGGGAATGG + Intronic
1005995022 6:30925716-30925738 GCAGGTGACCAGAGGGGATGGGG + Exonic
1006107312 6:31724264-31724286 GGGAGTGACCAGAGGTGGAAGGG + Intronic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006250609 6:32780292-32780314 TCATGTGACAAGAGGGCAAAGGG + Intergenic
1006581954 6:35082391-35082413 GGAAATGACCAGAGAGGAGATGG - Intronic
1007619141 6:43201097-43201119 GCAAATGCCCAAAGGAGAAATGG - Intronic
1009461589 6:63920347-63920369 GCAAGAGACCAGAGGGTAGGAGG + Intronic
1009856936 6:69276722-69276744 GCAAGTGACGAAAGGAGGAAAGG - Intronic
1010403931 6:75481169-75481191 CCAAGTGACTAGTGGGTAAATGG - Intronic
1011827409 6:91325765-91325787 GCAAGGGTTCAGAGGGGCAAGGG - Intergenic
1013988951 6:116230642-116230664 GGAAGTCACCAGAGAGGAAAGGG - Intronic
1014035512 6:116764015-116764037 GCAAGTCACCAAATGAGAAATGG - Intronic
1014259061 6:119195293-119195315 GCAAGTGAGCAGAGAGCAAGTGG - Intronic
1014429273 6:121347686-121347708 GCAAGTGACTAGGTGGGTAAAGG - Intergenic
1019954281 7:4401094-4401116 GTAAGTAACCAGTGGTGAAAAGG + Intergenic
1021662530 7:22934650-22934672 GCAAATCAGCAAAGGGGAAAAGG + Intergenic
1022473272 7:30694585-30694607 GCCAGGGACCGGAGGGGAATGGG + Intronic
1022775260 7:33520744-33520766 GCTAATGACCACAGAGGAAAAGG + Intronic
1024472175 7:49775473-49775495 GCAGGTGACCAGGAGGGAACTGG - Exonic
1029512991 7:101008459-101008481 GCCAGTGGCCAGGAGGGAAAGGG - Intronic
1029953439 7:104611592-104611614 GCAAGTGAAGAAAAGGGAAATGG + Intronic
1030166927 7:106564561-106564583 GAATGTGCCCAGAGCGGAAAGGG - Intergenic
1030991217 7:116302774-116302796 GCAAGTTCCAAGAGGAGAAAAGG + Intronic
1033197924 7:139342892-139342914 GCACTTGAGCATAGGGGAAATGG + Intronic
1036662247 8:10715924-10715946 GCAACTGACCAGGTGGAAAAAGG + Intergenic
1038484384 8:27923276-27923298 GCACGTGAGCAGAAGGGAAAGGG - Intronic
1039379374 8:37070654-37070676 GCAACTCACCAGACAGGAAAGGG - Intergenic
1039403805 8:37295638-37295660 ACAAGGGACTATAGGGGAAAAGG - Intergenic
1041536260 8:58928374-58928396 GCATCTGTCCAGTGGGGAAATGG + Intronic
1044707353 8:95021518-95021540 GCACGTGCCAAGAAGGGAAAAGG - Intronic
1044980292 8:97709281-97709303 GAAAGTCAACAGTGGGGAAAGGG + Intronic
1047523661 8:125614936-125614958 GCAGGAGACCAAAGGGCAAAGGG + Intergenic
1047851631 8:128863570-128863592 GCAAATGACCAGAGTGGAGTCGG - Intergenic
1049114298 8:140672628-140672650 GGAGGTGACCAGAGGGTGAATGG - Intronic
1049130001 8:140830400-140830422 GCAATTTACCACTGGGGAAAAGG + Intronic
1049283872 8:141764138-141764160 GCAAGTGACCAGAGAGGGAGAGG + Intergenic
1049388382 8:142355553-142355575 GCAAATGACCAGAGGATAACGGG + Intronic
1051305753 9:15707124-15707146 GCAAATGACAACAGAGGAAACGG - Intronic
1051768843 9:20554055-20554077 GGAACTGAACAGAGAGGAAAAGG - Intronic
1052207738 9:25863921-25863943 AGAAGTGAGCATAGGGGAAATGG - Intergenic
1052426912 9:28316613-28316635 GCAAGTCCCCAGAGAGGAACCGG + Intronic
1052837694 9:33264257-33264279 GGAGGTGACCAGGGAGGAAATGG - Exonic
1053478877 9:38401490-38401512 GCAGGGGACCAGAGGGATAAGGG + Intergenic
1055287079 9:74740105-74740127 CCAAATGACCAGAGGAGAATGGG + Intronic
1056688535 9:88786323-88786345 GGGAGTGGGCAGAGGGGAAACGG + Intergenic
1056836993 9:89963309-89963331 GGGAGTGACCAGGGAGGAAAGGG - Intergenic
1056931384 9:90880806-90880828 GTGAGTGAGCAGAGTGGAAACGG - Intronic
1057442989 9:95095598-95095620 GCAAGAAACCACAGGAGAAAAGG - Intergenic
1059023636 9:110601855-110601877 GCTTGTGACCTGAGGTGAAAGGG + Intergenic
1059494435 9:114697793-114697815 GAAATAGACCAGAGAGGAAAGGG - Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1060153568 9:121303673-121303695 TCAGGTAACCAGAGAGGAAAGGG - Intronic
1060687894 9:125628314-125628336 GCAGGTGACAAGGTGGGAAAAGG + Intronic
1062031965 9:134365810-134365832 GCAAGCCACCAGAGGGTAATGGG - Intronic
1062086017 9:134648917-134648939 GCAAGTGGCCAGAGGAGGCAGGG - Intronic
1186265162 X:7824687-7824709 GCAAGTCAACAGAAGGAAAAAGG - Intergenic
1189282768 X:39830545-39830567 CCAAGTGACCAGCTGGGACATGG - Intergenic
1189481537 X:41395770-41395792 TCAGCTGAACAGAGGGGAAATGG + Intergenic
1190427709 X:50348095-50348117 GCAAGAGGCAAGAGGGGAACAGG - Intronic
1192479531 X:71472832-71472854 GAAAGTGAGCAGAAGAGAAAAGG - Intronic
1193172841 X:78357002-78357024 GCATGAGCCCAGAGGGGAAAAGG - Intergenic
1194969155 X:100323827-100323849 GAAATTGCCTAGAGGGGAAAAGG + Intronic
1195958205 X:110356856-110356878 GCAAGAGAGCAGAAGGAAAATGG + Intronic
1197106331 X:122720883-122720905 GCAAGTGACATGAGAGGAAGAGG - Intergenic
1197839120 X:130726686-130726708 GCAAGAGACCAGGAGGCAAAGGG - Intronic
1197869838 X:131054309-131054331 GCAAGAGAGCACAGTGGAAAGGG - Intergenic
1198674760 X:139120073-139120095 GCGAGTGAGCTCAGGGGAAATGG - Intronic
1200816194 Y:7535423-7535445 GCAAGTTATCAGAGGAGAAATGG + Intergenic