ID: 947233857

View in Genome Browser
Species Human (GRCh38)
Location 2:227919910-227919932
Sequence CTGTAGGTGCAGAAGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 337}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947233857_947233863 12 Left 947233857 2:227919910-227919932 CCTTTCTGCTTCTGCACCTACAG 0: 1
1: 0
2: 0
3: 25
4: 337
Right 947233863 2:227919945-227919967 GCCCTCTGGCTGGTCAGTGGTGG 0: 1
1: 0
2: 2
3: 39
4: 330
947233857_947233862 9 Left 947233857 2:227919910-227919932 CCTTTCTGCTTCTGCACCTACAG 0: 1
1: 0
2: 0
3: 25
4: 337
Right 947233862 2:227919942-227919964 ATTGCCCTCTGGCTGGTCAGTGG 0: 1
1: 0
2: 2
3: 13
4: 135
947233857_947233860 -2 Left 947233857 2:227919910-227919932 CCTTTCTGCTTCTGCACCTACAG 0: 1
1: 0
2: 0
3: 25
4: 337
Right 947233860 2:227919931-227919953 AGCTGGTGATCATTGCCCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 99
947233857_947233866 20 Left 947233857 2:227919910-227919932 CCTTTCTGCTTCTGCACCTACAG 0: 1
1: 0
2: 0
3: 25
4: 337
Right 947233866 2:227919953-227919975 GCTGGTCAGTGGTGGTCTCCAGG 0: 1
1: 0
2: 2
3: 24
4: 198
947233857_947233867 21 Left 947233857 2:227919910-227919932 CCTTTCTGCTTCTGCACCTACAG 0: 1
1: 0
2: 0
3: 25
4: 337
Right 947233867 2:227919954-227919976 CTGGTCAGTGGTGGTCTCCAGGG 0: 1
1: 1
2: 0
3: 15
4: 188
947233857_947233861 2 Left 947233857 2:227919910-227919932 CCTTTCTGCTTCTGCACCTACAG 0: 1
1: 0
2: 0
3: 25
4: 337
Right 947233861 2:227919935-227919957 GGTGATCATTGCCCTCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947233857 Original CRISPR CTGTAGGTGCAGAAGCAGAA AGG (reversed) Intronic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
900482404 1:2905539-2905561 CTGGAGGGGAAGCAGCAGAAGGG - Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901718822 1:11178629-11178651 CTGGATGTGAAGAAGCAGAAAGG - Intronic
902390837 1:16104625-16104647 CAGCAGTTGCAAAAGCAGAAGGG - Intergenic
902712417 1:18249503-18249525 CTGTACGTGCAAAAGCAGTGTGG + Intronic
903186002 1:21629427-21629449 ATGTGGGTGCAGAACCAGAGCGG + Intronic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904581709 1:31548625-31548647 GCGTGGGTGCAGCAGCAGAATGG + Intergenic
904635606 1:31878436-31878458 CTGTGGCTGCAGCAGCACAAAGG + Intergenic
904671983 1:32172880-32172902 CTTTAGGTCTATAAGCAGAAGGG - Exonic
904790835 1:33019437-33019459 ATGTAGGTCGAGAAGCAGTAGGG - Intronic
905010334 1:34742725-34742747 CTGTAGGGGCAGAAGCTGCTGGG - Intronic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
906774335 1:48515174-48515196 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
913082804 1:115404672-115404694 CTGTAGGTCAAGAAGCAAGAGGG + Intergenic
916523015 1:165581924-165581946 ATGCCGGTGCAGAAGCAGACCGG + Intergenic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917332455 1:173895596-173895618 CTGGAGGTGTAGAGGTAGAATGG - Exonic
917799324 1:178555917-178555939 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
918124067 1:181567083-181567105 CTTTTGGTGGAGAAGGAGAAAGG + Intronic
919278858 1:195459805-195459827 CTGTTGTTGCAGAAGCAACAGGG + Intergenic
920203563 1:204275549-204275571 GGGTAGGTGCAGAGGCAGATGGG + Intronic
922616522 1:226964337-226964359 CTCCTGGTTCAGAAGCAGAAAGG + Intronic
922987454 1:229877015-229877037 TGGTTGGGGCAGAAGCAGAATGG + Intergenic
923518684 1:234719565-234719587 TTGCAGGGGCAGAAGCTGAAAGG - Intergenic
1063040211 10:2330028-2330050 TTGAAGGTCCAGAAGGAGAAGGG + Intergenic
1065124809 10:22564142-22564164 CTATAGGTGCAACAGCGGAACGG + Intronic
1065965314 10:30766049-30766071 TTGTAGGGGTGGAAGCAGAAAGG - Intergenic
1066571554 10:36778607-36778629 CTGCAGGGTCAGAAGCAGAATGG - Intergenic
1066715125 10:38278228-38278250 CTCCAGGTCCAGAAGCAGAGGGG + Intergenic
1066801708 10:39199662-39199684 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1067485914 10:46649903-46649925 CATTAGGTAAAGAAGCAGAAAGG + Intergenic
1067608842 10:47691750-47691772 CATTAGGTAAAGAAGCAGAAAGG - Intergenic
1068166384 10:53337528-53337550 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1069546177 10:69330499-69330521 CAGTACCTGCAGAACCAGAACGG + Intronic
1070122295 10:73589841-73589863 CTGTAGGGGCAGGAGGTGAAGGG + Intronic
1070174499 10:73958532-73958554 CTGAAGGTGCAGTGGCACAATGG - Intergenic
1071624426 10:87153397-87153419 CATTAGGTAAAGAAGCAGAAAGG - Intronic
1071836037 10:89417879-89417901 ATGTACATGCAGAAGCTGAAGGG + Exonic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1072239569 10:93483021-93483043 CTGTAGGTCCAGAAACAGTGGGG - Intergenic
1072708043 10:97696314-97696336 CTGTTCCTGCAGAAGCATAATGG - Intergenic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1074481611 10:113826931-113826953 CTGGAGGTGCAACAGCAGAGGGG - Intergenic
1076310416 10:129502272-129502294 GTGTAGATGAAGAAGCAGACAGG - Intronic
1076612982 10:131737936-131737958 GTGCAAGTGCAGAGGCAGAAAGG + Intergenic
1078181154 11:9012278-9012300 CTGCTGGTGGAGATGCAGAATGG - Intergenic
1079321256 11:19453615-19453637 CTGCAGGTTCAGGAGCAGATGGG - Intronic
1080639265 11:34149289-34149311 CTGTCGGTGCAGGAGCAGACTGG + Intergenic
1080689091 11:34540943-34540965 CTTCAGGGGCAGAAGCAGAGAGG - Intergenic
1080787333 11:35487477-35487499 CTGGAAGTGCAGCAGCAGAAGGG - Intronic
1081471507 11:43376591-43376613 CTGTAAGTCCAGAAGCAAAAAGG - Intronic
1082301587 11:50512493-50512515 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1085259712 11:75197481-75197503 CTGTTGGAGCAGAAGCACAAGGG + Intronic
1086582347 11:88413686-88413708 CTGTAGGGGCAGCAGTAGCAGGG - Intergenic
1087195059 11:95296962-95296984 CTCTAGGTGGGGCAGCAGAAGGG - Intergenic
1087374707 11:97326526-97326548 GTGTAGAGGCAGTAGCAGAAAGG + Intergenic
1088792870 11:113241651-113241673 CTGAATGTGCAGGAGTAGAAGGG + Intronic
1089047278 11:115513167-115513189 CTTTCCGTGCAGAAGCAGAGGGG + Intergenic
1089525370 11:119093654-119093676 CTATTGAGGCAGAAGCAGAAAGG - Intergenic
1089793583 11:120962339-120962361 CAGCGGGTGGAGAAGCAGAAGGG + Intronic
1090067763 11:123518182-123518204 CGTTAAGTGCAGCAGCAGAAGGG + Intergenic
1090723984 11:129505287-129505309 CTGAAGCTGCAAATGCAGAAAGG + Intergenic
1091287169 11:134413855-134413877 GGGCAGGTGCAGAAGCAGGATGG + Intergenic
1091718831 12:2797706-2797728 CTGCAGGTACAGAAGCAAACAGG - Intronic
1091941475 12:4487510-4487532 AGATAGGAGCAGAAGCAGAATGG - Intergenic
1092945997 12:13454523-13454545 GTGTAGGGGCAGAGGCAGATGGG + Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1093553274 12:20440795-20440817 CTCTAGCTCCAGGAGCAGAAAGG - Intronic
1094571422 12:31644543-31644565 CTGTATGTGCAGCAACAGATAGG - Intergenic
1095184974 12:39190811-39190833 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096450434 12:51736078-51736100 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
1096845394 12:54403737-54403759 CTGGACTGGCAGAAGCAGAAGGG - Exonic
1097688381 12:62712006-62712028 CTCTAGCTGCAGGAGCAGCAGGG - Intronic
1097770905 12:63583715-63583737 CTGAAGGTGCATCAGCAGCAAGG + Intronic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1099084367 12:78226813-78226835 CTGTGCGTGAAGAAGCAGAAAGG + Intergenic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1101501124 12:105304694-105304716 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
1102485648 12:113253785-113253807 CTGTGTGTGGAGAAGCAGCAAGG + Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1104443453 12:128814147-128814169 AGGAAGGTGCAGTAGCAGAATGG - Intronic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1106975378 13:35205238-35205260 ATGTAGGTGCAGAAAAAGATCGG + Intronic
1107868975 13:44729725-44729747 CTGCAGTTGCAGAGGCAGAGTGG + Intergenic
1108012541 13:46034190-46034212 GTGTAGGTGGAGATGCAAAATGG + Intronic
1109582742 13:64363716-64363738 TTGTAGGTCTAGAAGCAGACAGG - Intergenic
1110410170 13:75196015-75196037 CTGTGGCTGTAGAAACAGAATGG - Intergenic
1112660560 13:101502923-101502945 CTGTAGATGGAGAGGCATAATGG - Intronic
1113788562 13:113015604-113015626 CTGTAGGTGCAGGTGCGGGATGG - Intronic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115103044 14:29726228-29726250 CAGTAGGGGCAGCAGCAGAAGGG - Intronic
1115440250 14:33426243-33426265 ATGTGGATGCAGAAGCAGATAGG + Intronic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1118833086 14:69453235-69453257 CTTTAGATCCAGAAGCAGCAAGG + Exonic
1120109414 14:80535954-80535976 CTGTAGGTGCAAAAGCCACAGGG - Intronic
1120177627 14:81311988-81312010 CAGTAAGTGAATAAGCAGAATGG + Intronic
1121396302 14:93626282-93626304 GTGTAGGTGCAGAAGCTGGAAGG - Intronic
1121573377 14:94964218-94964240 TTGTGGGTACAGAAGCAGGAGGG - Intergenic
1121685419 14:95831873-95831895 ATGGAGGTGCAGAGACAGAAGGG - Intergenic
1122198110 14:100104946-100104968 CTGTAGCTGAAGGAGAAGAAGGG + Intronic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124371385 15:29106607-29106629 CTGCAGCTGGAGAAGCACAAGGG + Exonic
1124559135 15:30755903-30755925 TTGGAGGTGCCGATGCAGAAAGG - Intronic
1124672124 15:31649821-31649843 TTGGAGGTGCTGATGCAGAAAGG + Intronic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1125709522 15:41773781-41773803 CTTTAGGTGAGGAAGCACAATGG + Intergenic
1125736085 15:41926859-41926881 CTGTAGTTGGAGAAGAGGAAAGG - Intronic
1127759114 15:62120686-62120708 CTGGAGGTGCAGCAGTGGAAAGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1131472172 15:92706944-92706966 CTGTGGGCTCAGAAGCACAAAGG + Intronic
1131680410 15:94715838-94715860 CTGTAGGTTCATGATCAGAAGGG + Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1135939413 16:26808401-26808423 CTCTAGGTGCAGAAATAGATGGG - Intergenic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1140188757 16:72796767-72796789 CAGAAGGTGCAGAAAAAGAATGG - Exonic
1140986619 16:80163956-80163978 GTGTGGGTGCAGATGCAGGAGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141657224 16:85422705-85422727 CTGCAGGTGCAGAAGCCGCTTGG + Intergenic
1146647398 17:34584255-34584277 TGGTGGGTGCAAAAGCAGAAAGG - Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1148964909 17:51426993-51427015 CTGTGGGTTCTGAAGAAGAAAGG + Intergenic
1149992064 17:61388823-61388845 CTGCAGGGGGAGGAGCAGAAGGG + Intronic
1151321417 17:73354791-73354813 CAGAGGGTGCAGAAGCAGAACGG - Intronic
1151474083 17:74335660-74335682 CTGGAGCTGCAGCAGCAGATGGG + Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1152092120 17:78252814-78252836 CTTCAGGAGCAGAAGCAGACTGG - Intergenic
1152351050 17:79784311-79784333 CTGAAGGTGAGGACGCAGAAAGG + Exonic
1152743847 17:82030370-82030392 GTGGAGCTGCAGGAGCAGAACGG + Exonic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1156294885 18:35780504-35780526 CTGCAGGTGCAGGAGCTGCATGG + Intergenic
1157913888 18:51645488-51645510 CAGTGGGTCCAGAAGCAGCATGG + Intergenic
1158594573 18:58804871-58804893 CTGTAGTTAGAGAAGAAGAAAGG - Intergenic
1158686183 18:59616636-59616658 TTGTAGGGGGAGAAGCATAAAGG - Intronic
1159568420 18:70083239-70083261 CTGTGGATGCAGAAGCATACTGG - Intronic
1160801803 19:973850-973872 CTGGAGCTGCTGGAGCAGAAAGG + Exonic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1162652417 19:12100129-12100151 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
1164840912 19:31391415-31391437 GTGAAGGGCCAGAAGCAGAATGG + Intergenic
1167347534 19:48955648-48955670 GTGAGGGTGCAGAATCAGAACGG - Intronic
1167917233 19:52751397-52751419 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925357258 2:3250583-3250605 CTTTGAGGGCAGAAGCAGAATGG + Intronic
925866700 2:8234485-8234507 GGGCAGGTGCAAAAGCAGAAGGG - Intergenic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
930231838 2:48851151-48851173 CAGTAGGTTCAGTAGCAGAGTGG - Intergenic
932498847 2:72162434-72162456 CTGTAGATGGAGAAGCAGTTAGG - Intergenic
933909515 2:86927541-86927563 ATCTAGTTGCAGAAGCAGATTGG + Intronic
934023210 2:87975838-87975860 ATCTAGTTGCAGAAGCAGATTGG - Intergenic
934713485 2:96530180-96530202 CTGGGCGTGCAGCAGCAGAAAGG + Intergenic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
936151410 2:110024176-110024198 CTGTAGGTGGAGGAGCTGACAGG + Intergenic
936193265 2:110347193-110347215 CTGTAGGTGGAGGAGCTGACAGG - Intergenic
936586680 2:113764252-113764274 TTATAGGTTCATAAGCAGAAGGG - Intergenic
940310665 2:152275433-152275455 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943395143 2:187324362-187324384 TTATAGGTCCAGAAGCAGAGAGG + Intergenic
943470168 2:188285285-188285307 CTGTTGATGCAGAACCAGCATGG + Intergenic
943876771 2:193075793-193075815 CTGAAGGTGCATAAACATAATGG - Intergenic
945122007 2:206467285-206467307 TTATAGGTGCATAGGCAGAAGGG - Intronic
945126369 2:206515527-206515549 CTGTAGGAGCAGAAGATTAAAGG - Intronic
946632340 2:221683837-221683859 CTATTGGTGCAGCAGCAGACAGG - Intergenic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948216412 2:236236747-236236769 CAGTCGGTGGAGAAGCAGCAAGG + Intronic
1171229502 20:23472122-23472144 CAGCAGCTGCAAAAGCAGAAGGG + Intergenic
1172631601 20:36382116-36382138 CTGGAGGTGGAGAAGCAGCCTGG + Intronic
1173495718 20:43515754-43515776 CTCTAGCTGCAGAAGCTGGAAGG + Intronic
1173639698 20:44592294-44592316 CTGAAGGAGCACCAGCAGAATGG - Intronic
1174732937 20:52935883-52935905 TTCTAGGTGCAGAAACAGGAAGG - Intergenic
1175953789 20:62597638-62597660 CTGCAGGTCCCTAAGCAGAAGGG - Intergenic
1177078887 21:16613765-16613787 CTGTAGGTGGAAATGCAAAATGG - Intergenic
1179086457 21:38222603-38222625 CTGCTGATGCAGAAGCAGACAGG + Intronic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1181043089 22:20202091-20202113 CAGTAGGTGCAGACGCAGGTGGG - Intergenic
1182342252 22:29632810-29632832 CTGTAGGTGCCTCAGCACAAGGG - Intronic
1183239919 22:36650077-36650099 GGGCAAGTGCAGAAGCAGAAAGG - Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183480893 22:38064979-38065001 CTGTGGGTGCATAAGGAGAGTGG - Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184857580 22:47154815-47154837 CTTTAGGAGCAGAAGCAGCCTGG + Intronic
1185126641 22:49014819-49014841 CTGGAGGTGCCGAAGCAGACAGG - Intergenic
949518351 3:4827179-4827201 CTGTCGGGGCAGGAGCAGGAGGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950650893 3:14406015-14406037 CTGTGGGTGGAGAAACAGGATGG + Intronic
951127603 3:19002127-19002149 CTGAAGGCACAGAAGCAAAAAGG - Intergenic
953847631 3:46440667-46440689 TAGAAGGAGCAGAAGCAGAAGGG + Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
956611673 3:71130083-71130105 CTGTAGATGCAGAATTACAAAGG + Intronic
958149410 3:89670885-89670907 CTGTAGGGGCAGAAGCCTCATGG + Intergenic
958838316 3:99172188-99172210 CTGTAGGTGCAATGGCAGAGAGG - Intergenic
960053002 3:113255276-113255298 CTGTTGGTTCAGGAGCAGACTGG - Intronic
960592018 3:119375957-119375979 CTCCAGGGGCTGAAGCAGAAGGG - Intronic
961621008 3:128225063-128225085 ATGTAGGGGCTGAAGCAGACAGG + Intronic
962201325 3:133403327-133403349 CTGCAGGTGGAGAAACAGGAGGG - Intronic
962292420 3:134147662-134147684 CTGTGGGTGCAGAGGCGCAAAGG - Intronic
963325271 3:143855616-143855638 ATGTAGGGATAGAAGCAGAAGGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963756978 3:149244822-149244844 CTGCAGGGGCAAAAGCACAAAGG - Intergenic
966978634 3:185109098-185109120 CAGCAGTTGCAAAAGCAGAAAGG + Intronic
967708017 3:192675048-192675070 CTTTAGGTGCAGAAAGAAAATGG + Intronic
968422448 4:497159-497181 CTGTCGATGCAGAAGCAGGCAGG + Intronic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
969942830 4:10751939-10751961 CTGGAGGTGCAAAAGCAAATGGG + Intergenic
971195029 4:24464916-24464938 GTGTAGTTGCTGAAGCAGAGGGG - Intergenic
972025686 4:34373857-34373879 CTGTATCTGCAAAAGCAGCATGG - Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
973652766 4:53013161-53013183 CTGTAGGTGTAAAGGAAGAATGG - Intronic
973749292 4:53997336-53997358 ATGTAGCTGCAGAATTAGAAAGG + Intronic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
975566673 4:75763347-75763369 CTGAAGGTGAAAAAACAGAATGG - Intronic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
976010303 4:80478635-80478657 ATTTATGTGCAGAAGCAAAATGG - Intronic
976521657 4:86035033-86035055 CTGTACTTAGAGAAGCAGAAGGG + Intronic
976718494 4:88148289-88148311 CTGTAGATGGAAAAGAAGAAAGG + Intronic
976977493 4:91182506-91182528 CAGCAGTTGCAAAAGCAGAAAGG - Intronic
977929811 4:102738080-102738102 CACTAGCTGCAGTAGCAGAAGGG - Intronic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
980468480 4:133218234-133218256 CTTTAGTTGTAGAAACAGAATGG + Intergenic
980917058 4:139043391-139043413 GTGGATGTGCAGAAGCAGAAAGG - Intronic
982553337 4:156830448-156830470 CTGTAGGTCCACATGGAGAATGG - Intronic
984956055 4:185046596-185046618 CAGCAGTTGCAAAAGCAGAAGGG - Intergenic
985027205 4:185749682-185749704 ATTTTGGTGCAAAAGCAGAATGG + Intronic
985735665 5:1579716-1579738 CAGCAGTTGCAGAAGCAAAAGGG - Intergenic
990306641 5:54500073-54500095 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
993406271 5:87515419-87515441 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
994112553 5:96023165-96023187 CTGTGGCTGCACAAGCAGTAGGG - Intergenic
994634450 5:102326784-102326806 TTGTAGTTGCAGAAGCCAAATGG - Intergenic
995547685 5:113249188-113249210 CTGTGGATCCAGAAACAGAAGGG + Intronic
995859913 5:116630025-116630047 TGGTCAGTGCAGAAGCAGAAAGG + Intergenic
996809777 5:127503795-127503817 CTGTAGTTGGAGAAGAAGTAGGG + Intergenic
996970035 5:129356034-129356056 CTTGAGATGAAGAAGCAGAAAGG - Intergenic
997552278 5:134763730-134763752 GTGTCTGTGCTGAAGCAGAAGGG + Intronic
997707883 5:135975812-135975834 CAGTAAGTGCAGAAGCGAAAAGG - Intergenic
997745758 5:136298778-136298800 TTGAAGGGGCAGAAGCAGGATGG - Intronic
999192267 5:149757170-149757192 CTGAAGCTGGAGAATCAGAAAGG + Intronic
1000664953 5:163983614-163983636 CAGTACGTGCAGAATGAGAAGGG + Intergenic
1001321186 5:170683152-170683174 CTCTAGGTGAAGAAAAAGAAGGG + Intronic
1003042563 6:2701497-2701519 GTGTAGGGGAAGATGCAGAAAGG - Intronic
1005318941 6:24632614-24632636 TTGTAGGTGCAGGAGCAGCTAGG - Intronic
1005857932 6:29877430-29877452 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1007863636 6:44942508-44942530 CAGTAGGTGCGGAATGAGAAAGG + Intronic
1008617717 6:53242260-53242282 CTGTAATCCCAGAAGCAGAAGGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1012198768 6:96378546-96378568 CTTTAGATGCATTAGCAGAATGG - Intergenic
1013108831 6:107048922-107048944 CTGTGGGCTGAGAAGCAGAAAGG - Intronic
1013475567 6:110504264-110504286 CAGAAGTTGCAAAAGCAGAAAGG + Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015386795 6:132633750-132633772 CTGCAGGAGCAAAAACAGAAAGG + Intergenic
1015683104 6:135830026-135830048 CTGTAAGTACATCAGCAGAAAGG - Intergenic
1015700732 6:136033499-136033521 CTGTGGGAGCAACAGCAGAAGGG - Intronic
1018745285 6:166757197-166757219 CTGCAAGTGCAGAAGCAAAGGGG - Intronic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1019938416 7:4271082-4271104 CCATAGGTGCAGAACCAGGAGGG + Intergenic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1022634166 7:32116220-32116242 TTGTAGGTGCAGAAATAAAAGGG - Intronic
1023020828 7:36010485-36010507 CTGTAGCTACAGGAGCTGAAGGG - Intergenic
1024101833 7:46040062-46040084 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1024332581 7:48170928-48170950 GTGCAGGTGCAGTAGCAGAGTGG + Intergenic
1024911596 7:54453243-54453265 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1025102643 7:56149009-56149031 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1025210873 7:57019101-57019123 CTGAGGGTCCAGAACCAGAACGG - Intergenic
1025661082 7:63557746-63557768 CTGAGGGTCCAGAACCAGAACGG + Intergenic
1029550666 7:101235629-101235651 CTGTTGGTGCTGAAGGGGAAAGG + Intronic
1030168390 7:106577186-106577208 CTGTGGGTCCAGAAACAGCAGGG - Intergenic
1031068576 7:117136002-117136024 CTGTAGGAGCTCATGCAGAAAGG - Intronic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1034031221 7:147766431-147766453 GTGTAGGTGAAGTAGAAGAAAGG + Intronic
1034240498 7:149607025-149607047 GTGTATCTGCGGAAGCAGAAGGG - Intergenic
1034942516 7:155240017-155240039 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1035644352 8:1206783-1206805 CTGCAGGTGCAGACAAAGAATGG - Intergenic
1036007029 8:4676608-4676630 CTGCAGGTGCGAAAGGAGAATGG - Intronic
1036190552 8:6665949-6665971 TTGTGGCTGCAGAGGCAGAAAGG - Intergenic
1037365400 8:18116542-18116564 CTTTAGGTGCAGGTGCAGATGGG - Intergenic
1037455894 8:19063736-19063758 CTGAAGGTGCATAGTCAGAAAGG + Intronic
1038154611 8:24977039-24977061 CTGTTGGTGGAGATGCAAAATGG - Intergenic
1039705946 8:40007607-40007629 CTATAGATGCAGAAACAGACTGG + Intronic
1040101988 8:43513670-43513692 CTTTATGTCCAGATGCAGAAAGG + Intergenic
1040528570 8:48246299-48246321 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1040835110 8:51723017-51723039 CTGTATGTGGAGATGCAAAATGG + Intronic
1041065099 8:54075083-54075105 CAGCAGTTGCAAAAGCAGAAAGG + Intronic
1041597266 8:59669749-59669771 ATGTAAGTGCCGTAGCAGAATGG + Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043673980 8:82925850-82925872 CTGAAGGAGCAGAAGTAAAAGGG + Intergenic
1045600730 8:103712709-103712731 CTGTAGATACAGAAACACAAAGG + Intronic
1046836079 8:118803077-118803099 CTGTAGGAGGGGAAGCAGATGGG + Intergenic
1048571256 8:135658950-135658972 AGGTGGGTGCAGAAGCAGGAAGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048919311 8:139213448-139213470 CTGCAGGTGCTGCTGCAGAAGGG - Intergenic
1048953532 8:139515283-139515305 CTATAGGTGCAGATGTAGAGAGG - Intergenic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1050408191 9:5332251-5332273 TTGTATGTGCAGAAGTAGACTGG + Intergenic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1053238920 9:36480427-36480449 TCCAAGGTGCAGAAGCAGAATGG + Intronic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053545151 9:39015113-39015135 TTGTAGGTGCAGAAGAGGAAAGG - Intergenic
1053593384 9:39534591-39534613 CTGGAGCTGCTGGAGCAGAAAGG - Intergenic
1053809551 9:41838306-41838328 TTGTAGGTGCAGAGGAGGAAAGG - Intergenic
1053851118 9:42289299-42289321 CTGGAGCTGCTGGAGCAGAAAGG - Intergenic
1054572922 9:66830686-66830708 CTGGAGCTGCTGGAGCAGAAAGG + Intergenic
1054621041 9:67349122-67349144 TTGTAGGTGCAGAGGAGGAAAGG + Intergenic
1056336115 9:85571005-85571027 CCTTAGGTGTAGAATCAGAATGG + Intronic
1056497255 9:87170506-87170528 CTGTTGGTCAAGAGGCAGAAAGG + Intergenic
1056579334 9:87879181-87879203 CTGTAGGGTCTGAAGCACAAAGG - Intergenic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1060426468 9:123510765-123510787 CAGAAGGTGGAGGAGCAGAAAGG + Intronic
1060493243 9:124100209-124100231 ATGTCGGGGCAGAAGCAGAAGGG - Intergenic
1061099923 9:128484758-128484780 CTGAAGGAGTTGAAGCAGAAGGG + Exonic
1061329696 9:129884891-129884913 GTGTAGGTGAAGTTGCAGAAGGG - Intergenic
1061602951 9:131684509-131684531 CAGCAGTTGCAAAAGCAGAAAGG + Intronic
1061729491 9:132602566-132602588 CTCTAGGTCTGGAAGCAGAACGG - Intronic
1062540985 9:137041492-137041514 TTGGAGGTGGGGAAGCAGAAGGG - Intronic
1185761579 X:2692810-2692832 CAGTAGGTGCAAAAGAAGGAAGG - Intronic
1190278508 X:48914295-48914317 CTGTAGGCCAAGAAGCAGAGAGG + Intronic
1190931568 X:54953028-54953050 CTGTTTGTGTAGAAGCTGAAGGG + Intronic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1192687274 X:73320124-73320146 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic
1193048819 X:77079989-77080011 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194076399 X:89399967-89399989 CTCAAGCTGCAGTAGCAGAAGGG + Intergenic
1194703018 X:97137664-97137686 CTGTTGGTGCAAAAGCACAGTGG + Intronic
1194807734 X:98350363-98350385 CTGTCAGTGCAAAAGCAGAAAGG - Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1196838395 X:119834926-119834948 CTGGAGATTCAGCAGCAGAAAGG - Exonic
1197124577 X:122929333-122929355 TTGTAAGGGCAGAAGCACAAAGG + Intergenic
1197245418 X:124161754-124161776 CTGTAGGTCCAGAAGCAAATAGG + Intronic
1197900057 X:131361256-131361278 TTGTATGTGCAGAAGTAGACTGG - Intronic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1198633543 X:138669907-138669929 CTGAAGTGTCAGAAGCAGAAAGG + Intronic
1199007100 X:142713263-142713285 CTGAAGCTGCTGAAGCACAAAGG - Intergenic
1200915306 Y:8566155-8566177 CTGTAGGATGAGAAGCAGAAAGG + Intergenic
1201900535 Y:19043183-19043205 CTGTAGCTGCAAAAGGACAAGGG - Intergenic
1202140546 Y:21717167-21717189 CAGCAGTTGCAAAAGCAGAAAGG + Intergenic
1202146319 Y:21786630-21786652 CAGCAGTTGCAAAAGCAGAAAGG - Intergenic