ID: 947238696

View in Genome Browser
Species Human (GRCh38)
Location 2:227971031-227971053
Sequence GCCATGACCCATGTGGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947238692_947238696 27 Left 947238692 2:227970981-227971003 CCTCTACTACACGGTGTCACTGT No data
Right 947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947238696 Original CRISPR GCCATGACCCATGTGGCCCT TGG Intergenic
No off target data available for this crispr