ID: 947240690

View in Genome Browser
Species Human (GRCh38)
Location 2:227991116-227991138
Sequence GGTCAAAGTTGATCACCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947240684_947240690 24 Left 947240684 2:227991069-227991091 CCACTGCAGAGTGGCTCGGAGCT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 947240690 2:227991116-227991138 GGTCAAAGTTGATCACCAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947240690 Original CRISPR GGTCAAAGTTGATCACCAGC AGG Exonic
903834964 1:26197854-26197876 AGGCAAAGCTGATCTCCAGCTGG - Intronic
904865036 1:33571619-33571641 GGTCACAGATGAGCATCAGCTGG + Exonic
907074554 1:51566463-51566485 GGTTAAAATTGACAACCAGCAGG - Intergenic
907136477 1:52142970-52142992 GGTGAAATTTCATCACCTGCCGG + Intronic
912333670 1:108843079-108843101 GGTCAAAGGTGATCTCCTTCAGG - Intronic
915501433 1:156321460-156321482 GGTCAAAGATGACCACCAACTGG + Intronic
923750081 1:236739442-236739464 TGTTGAAGTTGATCTCCAGCTGG - Exonic
1066047289 10:31604522-31604544 GGCATAAGCTGATCACCAGCTGG + Intergenic
1067543768 10:47176980-47177002 GTTCAAAGTTAATGACCATCTGG - Intergenic
1071960034 10:90801215-90801237 GGTCAAGGTTTATTGCCAGCTGG + Intronic
1078100476 11:8327670-8327692 GGCCATAGCTGACCACCAGCTGG + Intergenic
1083145541 11:60755670-60755692 GCTCAGAGTGGATCACCAGAGGG - Intergenic
1084043849 11:66557839-66557861 TGTTGAAGTTGATCTCCAGCTGG - Exonic
1084095247 11:66907066-66907088 GCTCATAGTTCAGCACCAGCCGG - Intronic
1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG + Exonic
1090346068 11:126071944-126071966 GGTCAAAGTTGATCATCACCAGG + Intergenic
1099905400 12:88764132-88764154 GGTGAAAAATGATCATCAGCTGG + Intergenic
1100190238 12:92182647-92182669 GGGCAAAGTTGAACACCTTCTGG - Intergenic
1106899363 13:34338795-34338817 GGTCAAAGTAGGATACCAGCTGG - Intergenic
1108898461 13:55365724-55365746 GATCAAAATTTATGACCAGCAGG - Intergenic
1110324302 13:74196303-74196325 GGTCAATGGGGAGCACCAGCAGG + Intergenic
1114512906 14:23277109-23277131 GGTCTCAGTAGTTCACCAGCGGG - Exonic
1114521064 14:23336481-23336503 GGTTAAAGTTGACAACCAGCTGG + Intergenic
1118763005 14:68892121-68892143 TGTTGAAGTTGATCTCCAGCTGG + Exonic
1121876185 14:97455695-97455717 GGTCTCAGTTCTTCACCAGCTGG - Intergenic
1124525942 15:30452643-30452665 GGTCAAATCAGATCACCAGGAGG - Intergenic
1124772713 15:32555042-32555064 GGTCAAATCAGATCACCAGGAGG + Intergenic
1124925069 15:34063077-34063099 GGTCAAAACTGATCACCAGAAGG - Exonic
1131662225 15:94530168-94530190 GTTCAAATTTGAGCACCATCAGG + Intergenic
1131822609 15:96288092-96288114 GGGCATAGCTGTTCACCAGCTGG + Intergenic
1133139221 16:3732032-3732054 GGCCAAAGTAGGTCACCACCAGG + Intronic
1134022958 16:10934076-10934098 TGCCAAAGCTGATCAGCAGCGGG + Intronic
1136448693 16:30339980-30340002 GGTCAAAGCAGGTCACCAGGTGG + Intergenic
1137265228 16:46863284-46863306 GTTGAAATTTGATCCCCAGCCGG - Intergenic
1142047169 16:87932883-87932905 GGTCAAAGCAGGTCACCAGGTGG - Intronic
1151577808 17:74961744-74961766 AGTTAAAGTTCATCACCACCAGG + Intronic
1152829971 17:82491137-82491159 GGTCAGCCTGGATCACCAGCGGG - Intergenic
1156784935 18:40899680-40899702 GGACAAAGATGATCAACAGAAGG - Intergenic
1165828134 19:38717226-38717248 TGTTGAAGTTGATCTCCAGCTGG - Exonic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
935434056 2:103008968-103008990 GGTCACAGTTAGTCAGCAGCAGG - Intergenic
935485133 2:103644032-103644054 AATCAAAGCTGATCACCACCAGG + Intergenic
935587306 2:104813173-104813195 GGCAAAAACTGATCACCAGCTGG + Intergenic
940673902 2:156705253-156705275 GGCACAAGTTGATCTCCAGCTGG + Intergenic
941196517 2:162459511-162459533 GGCCAAAGTTTATGACAAGCAGG + Intronic
943598249 2:189883082-189883104 GCTCAAAGTTGATAACCACTGGG - Intronic
945253015 2:207780054-207780076 TGTATAAGTTGATCACCAACTGG - Intergenic
946136877 2:217654892-217654914 GGTGAAATTTTATCACCAGAGGG + Intronic
947240690 2:227991116-227991138 GGTCAAAGTTGATCACCAGCAGG + Exonic
1169491799 20:6077328-6077350 GGTCAAACTCGATGACCACCTGG + Exonic
1173311512 20:41900297-41900319 GATGAAAGTGGCTCACCAGCTGG - Intergenic
1179061092 21:37980208-37980230 GGTCAAGGATGATGACCAGCAGG + Intronic
1181588363 22:23867012-23867034 GGCCAATGGTGAGCACCAGCAGG - Intronic
1183213531 22:36465297-36465319 GGTCAAACAGGATCACCAGGAGG + Intergenic
949465040 3:4335373-4335395 GGTCAAAGTTAATTGTCAGCTGG - Intronic
951711619 3:25589729-25589751 GGTCAAAGTTGATCCTCCTCAGG - Intronic
958177428 3:90014200-90014222 GGCCAGAGTTCATGACCAGCTGG + Intergenic
973828639 4:54735907-54735929 GGTCCAAGATGACCACCAGGTGG + Intronic
978612167 4:110554449-110554471 GGTAAAAATTTATCACAAGCAGG - Intronic
984517415 4:180757742-180757764 GGATTAAGTTGATTACCAGCGGG + Intergenic
984996370 4:185434457-185434479 AGTCAAAGTTTATCACAGGCAGG - Intronic
986008048 5:3684445-3684467 GGTCAAAATTGAAACCCAGCAGG - Intergenic
988196076 5:28007740-28007762 GGTCAAAGTGGAGTACCAGCAGG - Intergenic
999266717 5:150271318-150271340 GGTCAAAGAGGATCAGCAGAGGG - Intronic
1000072658 5:157755171-157755193 GCCCAAAGTGGATTACCAGCAGG + Exonic
1000409400 5:160922236-160922258 GGTCTGGGTTTATCACCAGCTGG + Intergenic
1002442822 5:179273179-179273201 GGTTCAAGCTGAGCACCAGCTGG - Intronic
1002655093 5:180739695-180739717 GGTCAAAGGCCATCACCACCAGG + Exonic
1005192328 6:23239423-23239445 TGTCGAAGTTGATAAACAGCTGG + Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1008840099 6:55892717-55892739 GGTCAATGTTGAATACCTGCAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025760897 7:64390367-64390389 TGTTAAAGTTGCTCAACAGCAGG + Intergenic
1035310135 7:157962438-157962460 TGTCAAACTCGGTCACCAGCAGG + Intronic
1041255391 8:55976119-55976141 GGGCAGAGTTTATCACCAGCTGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1188904869 X:35779832-35779854 GGTTAAAATTGACAACCAGCTGG - Intergenic
1189896939 X:45665425-45665447 ACTCAGAGTTGATCACCAGAAGG - Intergenic
1191900527 X:66035561-66035583 GGTGAAAATTCACCACCAGCTGG - Intronic
1192964889 X:76166803-76166825 GGTCTAAGTTTATCACTAGATGG + Intergenic
1196884436 X:120229364-120229386 GGTTAAAATTGACAACCAGCTGG + Intergenic
1197175295 X:123479267-123479289 GGTCAACTTAGATCACCAGAGGG - Intronic