ID: 947241267

View in Genome Browser
Species Human (GRCh38)
Location 2:227996929-227996951
Sequence GCTTCTGGATCTTCATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947241267_947241270 -7 Left 947241267 2:227996929-227996951 CCTGTAGATGAAGATCCAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 947241270 2:227996945-227996967 CAGAAGCCCAGTGAGATTGGAGG 0: 1
1: 0
2: 3
3: 24
4: 259
947241267_947241268 -10 Left 947241267 2:227996929-227996951 CCTGTAGATGAAGATCCAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 947241268 2:227996942-227996964 ATCCAGAAGCCCAGTGAGATTGG 0: 1
1: 0
2: 0
3: 15
4: 250
947241267_947241271 -6 Left 947241267 2:227996929-227996951 CCTGTAGATGAAGATCCAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 947241271 2:227996946-227996968 AGAAGCCCAGTGAGATTGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 285
947241267_947241274 10 Left 947241267 2:227996929-227996951 CCTGTAGATGAAGATCCAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 947241274 2:227996962-227996984 TGGAGGGCTTATCCTGAAACAGG 0: 1
1: 0
2: 0
3: 9
4: 90
947241267_947241275 16 Left 947241267 2:227996929-227996951 CCTGTAGATGAAGATCCAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 141
Right 947241275 2:227996968-227996990 GCTTATCCTGAAACAGGAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947241267 Original CRISPR GCTTCTGGATCTTCATCTAC AGG (reversed) Intronic
900097221 1:944785-944807 GCGTCTGGGTCTCCATCTGCGGG + Exonic
902472617 1:16659208-16659230 GCCTTTGGATTTTCATCTGCTGG - Intergenic
902486187 1:16748235-16748257 GCCTTTGGATTTTCATCTGCTGG + Intronic
902714573 1:18263567-18263589 GCTTCTGGATCTTAATTTTGGGG + Intronic
905341032 1:37277593-37277615 GCATCTGGACCTTCAGCTGCCGG + Intergenic
906417864 1:45635758-45635780 ACTTCAGAATCTTCTTCTACTGG + Intronic
910506198 1:87952612-87952634 GCTTCTGGGGCTTCATCTCTAGG - Intergenic
911253771 1:95610586-95610608 GCTGCTGGCTCTTCAAATACTGG - Intergenic
911533784 1:99077220-99077242 GCTTCTGGATCTCCCTGTCCAGG - Intergenic
912258025 1:108080957-108080979 ACTTCTAAATCTTCATTTACTGG + Intergenic
916531419 1:165660237-165660259 GCTTCTGGAACTTGATCAACTGG + Intronic
918003688 1:180522241-180522263 GCCCCTTGATCTTCAGCTACTGG + Intergenic
918677752 1:187309378-187309400 GCTACTAGATCTTCACCTAAAGG + Intergenic
918923363 1:190745354-190745376 GGTTCTGGATTTTCAGCTTCTGG + Intergenic
919699590 1:200618164-200618186 ACCTGTGGATCTTCATCTAAAGG + Exonic
921304282 1:213780393-213780415 GCCTAAGGATCTTCATCTATAGG + Intergenic
922649340 1:227323643-227323665 TCTTCTTGATCTTCAAATACTGG + Intergenic
1062860745 10:807464-807486 TCTTCTGCATCTGCATCTCCTGG + Exonic
1063508488 10:6623693-6623715 GCTTCTGGATCTTGATCCAGGGG + Intergenic
1068403916 10:56565537-56565559 ACTTCTGGATATTCATTTAAAGG + Intergenic
1069306331 10:66975423-66975445 GCTTCTGAATCATCAGCTACTGG + Intronic
1069605812 10:69737955-69737977 GCCTCTGGAACTTCATCTGCTGG - Intergenic
1071500329 10:86198952-86198974 GCTTCAGCCTCTTCATCTATAGG - Intronic
1073439053 10:103541649-103541671 GCCTCTGGATCTTCCACTGCAGG - Intronic
1074189848 10:111126137-111126159 GCTTCTGGCTCTCCATCTTCTGG + Intergenic
1079303127 11:19297252-19297274 GCTTCTTTATCTATATCTACTGG + Intergenic
1083783692 11:64931799-64931821 GCTCCTGGATCTTCACAAACTGG - Exonic
1085713306 11:78849973-78849995 GATTCTGGATCTCCACCTGCAGG + Intronic
1086375284 11:86194031-86194053 GCCTCTGGATCTTCAACTTTAGG + Intergenic
1089190270 11:116648603-116648625 GGTTCTGGCTCTCCATCTCCTGG - Intergenic
1090089735 11:123684596-123684618 GATTCTGGATCTTAATCATCAGG - Intergenic
1090716608 11:129437004-129437026 GCTTCTGGAATTTCTTCTCCAGG - Exonic
1093613848 12:21196135-21196157 GCTTCTGGATTTTCCACTAATGG + Intronic
1094068330 12:26385097-26385119 GCTTCTGCCTCCTCATCTAAAGG - Intronic
1094285907 12:28793361-28793383 GTCTCTGGTTCTTCACCTACAGG - Intergenic
1094874361 12:34624534-34624556 GCTACTGCATCTTCTTCAACAGG - Intergenic
1098845616 12:75531490-75531512 GATTCAGGAGCTACATCTACAGG - Intergenic
1102847098 12:116197159-116197181 GCTGCTGTATTTTCATCCACCGG - Intronic
1108385179 13:49892964-49892986 GGTTCTGGATCTTCAGCAGCAGG - Intergenic
1108392074 13:49956348-49956370 GCTTCTGCATCTGCTTCTGCTGG + Intergenic
1108590437 13:51908228-51908250 GGTTCTGGATCTTCAGCAGCAGG + Intergenic
1109127098 13:58530994-58531016 GGTTCTGGATCTTCAGCAGCAGG - Intergenic
1121908939 14:97771431-97771453 TCTTCTGGATCCCCATTTACTGG + Intergenic
1121928756 14:97952817-97952839 GCTTGTAGATCTTCAGCTAGAGG - Intronic
1129750523 15:78059683-78059705 GCTTCTGGGTTTTGAGCTACTGG - Intronic
1132097427 15:98998080-98998102 GCTCCTGGGTCTTGAGCTACAGG + Intronic
1135376836 16:21954338-21954360 TCTTCTGCATCTCCATCTAGGGG - Intronic
1135919820 16:26639585-26639607 GCTTCTGATTCCTCATCTATGGG + Intergenic
1143006048 17:3835043-3835065 GCTTCTGTTTCTTCATCCAGTGG - Intronic
1143098261 17:4490068-4490090 GGTTCTTGCTCTTCCTCTACTGG - Intergenic
1143866143 17:9925545-9925567 GCTGCTGGGTCTTCATCTCCAGG + Exonic
1144507892 17:15848972-15848994 GACTCTGGCTCTTCATCCACAGG - Intergenic
1145119604 17:20245927-20245949 GACTCTGGCTCTTCATCCACAGG - Exonic
1145172016 17:20666605-20666627 GACTCTGGCTCTTCATCCACAGG - Intergenic
1145202226 17:20956680-20956702 GACTCTGGCTCTTCATCCACAGG - Intergenic
1149491312 17:57086450-57086472 GTTTCGGGATCTTCCTCTCCTGG + Intronic
1149671977 17:58422416-58422438 CTTTCTAGATCTTCATCTGCTGG - Exonic
1150832357 17:68535519-68535541 TCTCCTGGTTCTTCATCCACAGG + Intronic
1150882635 17:69047880-69047902 GCCTCTGGATATTAATCTGCTGG + Intronic
1156539031 18:37891839-37891861 GCTTGTATTTCTTCATCTACTGG - Intergenic
1157666647 18:49492974-49492996 GCTTCTAGATCTTCATCTGGAGG + Intergenic
1158438179 18:57449256-57449278 TCTTCTGGATCTTAATCTAATGG - Intronic
1161364700 19:3871633-3871655 TCTTTTGGATCTTCATGCACTGG + Intergenic
1163029344 19:14534061-14534083 GCTTCTGGGTATTCAGCTGCGGG - Intronic
1164829984 19:31312957-31312979 GATTCTGGGTCTTCATTTATAGG + Intronic
1168138523 19:54368407-54368429 GCTTCTGACTCTTCTTTTACTGG + Intronic
1202705008 1_KI270713v1_random:16026-16048 GCCTTTGGATTTTCATCTGCTGG - Intergenic
928717177 2:34074451-34074473 GCCTCTGGATCTTCCTGTGCTGG + Intergenic
928981310 2:37138340-37138362 GCTTCTGAATCATCATCTGAAGG - Exonic
929349451 2:40931315-40931337 GCTTTTGCACCTTCATCTTCTGG + Intergenic
929991881 2:46797152-46797174 GTTCCTGGACCTTCATCTTCTGG - Intergenic
930152497 2:48072967-48072989 GTTTCTGTATATTCATCTTCTGG + Intergenic
930668973 2:54127772-54127794 GCTTCTGGAATTTCATCACCTGG + Intronic
932575620 2:72960918-72960940 GCTCCTGGCTCCTCATCTGCTGG + Intronic
938052453 2:128186818-128186840 GCTTCTGCATGTTCATCCACTGG + Intronic
939218556 2:139272441-139272463 CCTACTGTGTCTTCATCTACAGG - Intergenic
939676734 2:145081773-145081795 GCATCTATATCTTTATCTACAGG + Intergenic
940189900 2:151029615-151029637 GCTCCTGGAATTTCATCAACTGG - Intronic
940641320 2:156347153-156347175 GTTTCTCCATCTTCATCTCCTGG - Intergenic
941056266 2:160792378-160792400 ACTTCTGGATATACATCTAAAGG + Intergenic
941522822 2:166569830-166569852 CCTCCTGGATTTTCATCTCCAGG + Intergenic
943877475 2:193089652-193089674 CCTTCTGGATTTTCCTTTACTGG - Intergenic
947241267 2:227996929-227996951 GCTTCTGGATCTTCATCTACAGG - Intronic
947632813 2:231665030-231665052 GCTTCTGGACCCTCATGTCCTGG - Intergenic
1171262337 20:23745889-23745911 GCATGTGGACCTTCATCTTCTGG - Intergenic
1171860247 20:30394470-30394492 GCTTCTGGAAATTTATCTGCAGG - Intronic
1175263823 20:57690789-57690811 GCTCCTGGATCCTCACCAACTGG - Intronic
1176010252 20:62889615-62889637 GCTTCTCGGTCTTCACCTCCAGG + Intronic
1178702338 21:34844349-34844371 CCTCCTGGATCTTCTTCTCCTGG - Intronic
1179600747 21:42475957-42475979 ACGTCTGCATCTTCATCTCCAGG + Exonic
1180411995 22:12621755-12621777 GCTTCTGGAAATTTATCTTCAGG - Intergenic
1181949160 22:26541669-26541691 GCTTCTGGGGCTTCAGCGACAGG + Exonic
949151066 3:767474-767496 TCTGCTGGATCTTCATCTAATGG + Intergenic
949876933 3:8632491-8632513 CCTTCTTGATCTTCATCCATAGG + Intronic
952633072 3:35493349-35493371 GCTTCTGGGTCTTCTGCAACAGG - Intergenic
956297638 3:67731359-67731381 GCCTATGGATGTTTATCTACAGG + Intergenic
956396991 3:68836456-68836478 GCTTCTAGAACTTCCTCTAAGGG + Intronic
960348266 3:116561742-116561764 GCTACTGGATCTCCCTCTCCAGG - Intronic
961837083 3:129671111-129671133 GCTTCAGGATCTTCTGCTGCAGG + Exonic
961948491 3:130719983-130720005 GCTTCAGGTTCTGCATCTCCAGG - Intronic
974879199 4:67733332-67733354 GTTTCTGGAACTACATCTATTGG + Intergenic
975780321 4:77832363-77832385 GGTTCTAGATCATCATCAACAGG + Intergenic
983019109 4:162653307-162653329 CCTTGTAGATCTTCAACTACAGG + Intergenic
984909268 4:184656897-184656919 GATCCTGGTTCTTCATCTAATGG - Intronic
988659433 5:33248989-33249011 GCTTCTGAATTTTCAACTTCAGG - Intergenic
988960145 5:36362528-36362550 GATTCTGGAGTTTCATCTTCTGG - Intergenic
989411827 5:41128113-41128135 GCTTCTGGGCCCTCAGCTACTGG - Intergenic
992433501 5:76732609-76732631 GCTTCTTGACCTTCATTTTCAGG - Exonic
1000639136 5:163680225-163680247 GATTTTGGAGCTTCATCTTCAGG - Intergenic
1001168951 5:169398837-169398859 TCTTCTGGGTCTTCAGTTACAGG - Intergenic
1001739798 5:174043286-174043308 ACTACTGGATGTTCATCTAAAGG - Intergenic
1002351549 5:178587340-178587362 GCTTCTGTATCTTCATTATCGGG + Intronic
1002833678 6:847183-847205 GCAACTTGATCTTCAGCTACTGG + Intergenic
1003151032 6:3549092-3549114 CCCTCTGGATCTTTGTCTACTGG - Intergenic
1006075538 6:31529863-31529885 GCTTCTGGATCTTGAGCACCAGG - Exonic
1011996489 6:93595622-93595644 GCTCCTGGAAATTCATGTACAGG + Intergenic
1013513820 6:110867556-110867578 GATTCTGGAGCTTCAGCTTCTGG - Intronic
1014370835 6:120605616-120605638 GCATGTTGATCTTCAACTACTGG - Intergenic
1016334065 6:142984739-142984761 ACTCCTGGACTTTCATCTACAGG + Intergenic
1018842670 6:167529313-167529335 GCTTTTAGATGTTCATATACAGG - Intergenic
1019127782 6:169852381-169852403 GCCTCTGGCTCTTCCTCTGCTGG + Intergenic
1019783350 7:2957950-2957972 GCATCTTGATCTTGATCTTCAGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021640684 7:22733571-22733593 GTTTATGTATCTTCATCTTCAGG + Intergenic
1024038171 7:45526353-45526375 CCTGCTGGAGCTTCATCTGCAGG - Intergenic
1024351964 7:48375426-48375448 ATTTCTGGATCTTGATCTTCAGG - Intronic
1027258146 7:76444430-76444452 GCTTCTGGATCACCACCTCCAGG - Intergenic
1029016898 7:97324672-97324694 GCTTCTTTATCTTCAAATACTGG - Intergenic
1030167543 7:106570315-106570337 GCTACTCCACCTTCATCTACAGG + Intergenic
1039926933 8:41942911-41942933 CATTCTGGATCTACATCTACAGG + Exonic
1039950467 8:42167776-42167798 GCTGCTGGATCTTAAACTGCAGG - Exonic
1040546751 8:48403998-48404020 GCTTCAGGGTCTCCACCTACTGG - Intergenic
1042187577 8:66152373-66152395 TCTTCTTCATCTTCATCTTCTGG - Exonic
1043140865 8:76588629-76588651 GCTTAGGGATGTTCAGCTACTGG - Intergenic
1043686802 8:83096598-83096620 GTTTATGGATATTCATCTATAGG + Intergenic
1043878384 8:85512432-85512454 GCTTCTGGCTCTAGATCTAGGGG + Intergenic
1046771463 8:118120759-118120781 GCTTCTGTATCTTCCACTAGGGG - Intergenic
1048393624 8:133991371-133991393 GCTCCTGGAACTTCATCAGCTGG - Intergenic
1048969203 8:139634889-139634911 GCTTCTGGGACTTCATCTGAAGG + Intronic
1052622812 9:30935789-30935811 CCTTTTGGATCTTCATGCACTGG + Intergenic
1052650097 9:31291084-31291106 GCTTGTGGACCTTCCTGTACAGG + Intergenic
1058554684 9:106154354-106154376 GCTTCAGTTTCTTCATCTATAGG + Intergenic
1059925857 9:119208548-119208570 GCCTCTGGGTCCTCACCTACTGG - Intronic
1060373464 9:123097420-123097442 GCTTCCGGCTCTTCATCTGAGGG - Intronic
1060454771 9:123781440-123781462 ACTTCAGGCTCTTTATCTACAGG + Intronic
1061703091 9:132431007-132431029 TCTTCTGGTTCTTCAACCACAGG - Intronic
1202803528 9_KI270720v1_random:25277-25299 GCTTCTGGAAATTTATCTTCAGG + Intergenic
1187093487 X:16122074-16122096 GCTTCAGGTTCCTCATCTGCAGG - Intergenic
1188809698 X:34638164-34638186 GCTTCTGAATCTTAATCTAGTGG - Intronic
1196699192 X:118649178-118649200 GGCTCTGGATCTTGATCTAGAGG - Intronic
1197720903 X:129744011-129744033 GATTCTGGGTCTGCATCTGCTGG - Exonic
1199351715 X:146809892-146809914 GCTTCTGGACCTTCGTTGACGGG - Intergenic
1199352192 X:146814601-146814623 GCTTCTGGACCTTCGTTGACGGG + Intergenic
1199442174 X:147880783-147880805 ACTTCTTTATCTTAATCTACTGG + Intergenic
1201408694 Y:13675442-13675464 GCTTCTGGATGTTAATCCACTGG - Intergenic