ID: 947248341

View in Genome Browser
Species Human (GRCh38)
Location 2:228074976-228074998
Sequence GAGGAAAAAGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6541
Summary {0: 1, 1: 8, 2: 105, 3: 942, 4: 5485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947248333_947248341 13 Left 947248333 2:228074940-228074962 CCCAATGTTATAAAAAAGAAGGA 0: 1
1: 0
2: 3
3: 62
4: 630
Right 947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG 0: 1
1: 8
2: 105
3: 942
4: 5485
947248334_947248341 12 Left 947248334 2:228074941-228074963 CCAATGTTATAAAAAAGAAGGAA 0: 1
1: 0
2: 5
3: 133
4: 1134
Right 947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG 0: 1
1: 8
2: 105
3: 942
4: 5485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947248341 Original CRISPR GAGGAAAAAGAGAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr