ID: 947251775

View in Genome Browser
Species Human (GRCh38)
Location 2:228114763-228114785
Sequence TAGGAGAAGAAAAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1557
Summary {0: 1, 1: 0, 2: 14, 3: 143, 4: 1399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947251775 Original CRISPR TAGGAGAAGAAAAATGAGAA TGG (reversed) Intronic
900572716 1:3366705-3366727 TCGGAGCAGAAAAATGATTAGGG + Intronic
901472765 1:9469076-9469098 AAGGAGAACAAACATGACAAGGG - Intergenic
901761006 1:11471617-11471639 AAGGAGAAGGAAGAGGAGAAGGG + Intergenic
902533697 1:17106760-17106782 TAGGAGAAGAAAGATGAGAGAGG + Intronic
903448883 1:23439335-23439357 TAGGAGAAGAAAGAGGTAAAGGG - Intronic
903731603 1:25500420-25500442 AGGGAGAAAACAAATGAGAATGG - Intergenic
903965302 1:27085067-27085089 AAGGAGAAGAAAGAGAAGAAGGG - Intergenic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904391058 1:30186401-30186423 TGTGAGAAGAAAAATGGAAAAGG - Intergenic
904673281 1:32181550-32181572 CAGGAGAAGAAAAAAGCCAAGGG + Exonic
904781322 1:32951135-32951157 TTGAAGAAAAAAAATGAAAAAGG - Intronic
905034480 1:34908513-34908535 TAGGAGAGAGAAAATCAGAAAGG + Intronic
905256352 1:36688126-36688148 TAGGAGAAGAGATGTAAGAAGGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905378613 1:37543543-37543565 TGGGAGGGGAAAAAAGAGAAGGG + Intronic
905423848 1:37867607-37867629 GAGGGGAAGAAAAGTGAAAATGG + Intronic
905718999 1:40179748-40179770 AAGGTGAAGAAAAAAGGGAATGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906489565 1:46257704-46257726 CAAGAGAAGGAACATGAGAAAGG - Intronic
907166836 1:52419615-52419637 TAAGAGATGAAAAATAAGATTGG + Exonic
907562218 1:55401505-55401527 CAAGAGAAGACATATGAGAAGGG + Intergenic
907964412 1:59315386-59315408 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908438036 1:64126126-64126148 CAGGTGAAGAAAAATGAGAATGG + Intronic
908797370 1:67844101-67844123 TAGAAGGAGGAAAATGAGAGAGG - Intergenic
908912425 1:69087703-69087725 CAAGGAAAGAAAAATGAGAAAGG - Intergenic
908951181 1:69565392-69565414 TAGGACAAGATAAATGGGAAAGG + Intergenic
909105705 1:71404639-71404661 TAGCAGTTTAAAAATGAGAATGG - Exonic
909128107 1:71700903-71700925 AAAGAGATGAAAAATGATAAAGG + Intronic
909135272 1:71790981-71791003 GAGGAGGAGAAAAATAAGAGGGG + Intronic
909431036 1:75588187-75588209 TAGGAGAAGGAAAGAAAGAAGGG + Intronic
909478548 1:76109876-76109898 TAGTAGAAGAAACAATAGAAGGG - Intronic
909536881 1:76746945-76746967 TATCAGAAGAAAAGTAAGAAAGG + Intergenic
909591261 1:77351801-77351823 TAGAAGAAGACAAAGGAGAAAGG + Intronic
909805037 1:79863879-79863901 GAGGGGAAGAATAATTAGAATGG + Intergenic
910085746 1:83400215-83400237 GAGGAGGAAAAAAATGAAAAAGG - Intergenic
910089571 1:83446160-83446182 TTGCAGAGGAGAAATGAGAATGG + Intergenic
910373169 1:86540204-86540226 TAGAATTAGAAAAATGAGTATGG + Intergenic
910424716 1:87109442-87109464 TAGAAGAAAAAAATAGAGAAAGG + Exonic
910425543 1:87116884-87116906 TGGGAGAAGAACAGGGAGAAAGG - Intronic
910489629 1:87754833-87754855 TATGAGAAGAAAGATGCTAAAGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910549175 1:88456513-88456535 TGGGAGAAGGAAAAGGAGAGAGG - Intergenic
910667877 1:89743672-89743694 TGGGAGAGGAAAAAAAAGAAAGG + Intronic
910700625 1:90070309-90070331 TTTGAGATGAAAAATGATAATGG + Intergenic
911070417 1:93827741-93827763 AAGGAGGAGAGAAAGGAGAAGGG + Intronic
911341504 1:96644262-96644284 TAGGACAGGAAGAATGAAAAGGG - Intergenic
911452462 1:98081224-98081246 GAGGAGAAGGAAGAAGAGAAAGG + Intergenic
911768672 1:101711268-101711290 TAAAATAAGAAAGATGAGAAGGG - Intergenic
911803329 1:102173653-102173675 TTGGAAAAGAAAAATTAGAATGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911931287 1:103907272-103907294 TTTAAGAATAAAAATGAGAAGGG - Intergenic
911958548 1:104269371-104269393 TAACAGAAGAAAAAGGAGCAGGG - Intergenic
912058235 1:105632050-105632072 TGGCAGGAGAAAAATGAGAGTGG - Intergenic
912095248 1:106132576-106132598 AAAGAGAAGAAAAATCTGAAAGG + Intergenic
912596979 1:110888633-110888655 TAAGAAAAGGAAAATGAAAAAGG + Intronic
912601824 1:110943425-110943447 AAGGAGCAGAAAAATAAAAAAGG + Intergenic
912965632 1:114234843-114234865 AACCAGAAGAAAGATGAGAAAGG - Intergenic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
913251459 1:116915179-116915201 TAGGTGAAGAAAGATGATAGTGG + Intronic
913288900 1:117253773-117253795 AAAGAGAAGAAAAAAGAAAAAGG - Intergenic
913703055 1:121392377-121392399 AAAGAAAAGAAAAAAGAGAAAGG - Exonic
913939849 1:125091556-125091578 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
913979226 1:143493541-143493563 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
914043617 1:144072875-144072897 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
914073629 1:144319191-144319213 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
914105526 1:144647169-144647191 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
914134470 1:144887616-144887638 AAAGAAAAGAAAAAAGAGAAAGG + Exonic
914902313 1:151717206-151717228 AGGGGAAAGAAAAATGAGAAAGG + Intronic
914909737 1:151775166-151775188 TCTGAGAAGAAAAATGAAAAGGG + Exonic
914956784 1:152169704-152169726 TAGGGGAGAAAAAGTGAGAAGGG + Intergenic
914980898 1:152413459-152413481 TAGGAGAAGAAAGAGAAAAAAGG + Intronic
915537700 1:156547216-156547238 TGGAAGAATAAAAATGGGAAGGG + Intronic
915713465 1:157922840-157922862 AAGGAGAAGATAACTGTGAATGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
916165464 1:161963301-161963323 TATGAAAAGAAGAATGACAAAGG + Exonic
916510654 1:165469796-165469818 TGAGAGAGGAAAAATGGGAAAGG - Intergenic
916565294 1:165970639-165970661 TTGAAGAAGAAAAATAAGAAAGG - Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916661029 1:166922306-166922328 TAGGATAAAATATATGAGAAGGG + Intronic
916666596 1:166973311-166973333 TAGGAGAGGGCAAATGAGACTGG + Intronic
916699511 1:167276845-167276867 TAGAACAAAAAAGATGAGAAAGG + Intronic
916741958 1:167653995-167654017 TCAGAGAAGCAAAATGACAAAGG - Intronic
917189068 1:172394425-172394447 AAGGAAAAGGAAAATAAGAAAGG + Intronic
917338791 1:173953200-173953222 AAGTAGAAGAAAAATAAAAAAGG - Intronic
917683723 1:177394681-177394703 AAGGTGAAGAAAGTTGAGAAGGG + Intergenic
917758732 1:178132066-178132088 TAAGAGAAGGAAAAAGAGAAGGG - Intronic
917923531 1:179770536-179770558 CTGGAGATGAAAAATGAGACTGG - Intronic
918278285 1:182976398-182976420 TAGCACAAGAAAAATGAGAGAGG + Intergenic
918371212 1:183863291-183863313 AAGAAGAAGAAAAAAGAAAAAGG - Intronic
918658055 1:187053771-187053793 TTGGAGAATAAACATGAGAGGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919106076 1:193152610-193152632 AAGGAAAAGAAAAATGAAACAGG - Intronic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919147474 1:193654134-193654156 TAGAAGAAGAGAAAAGAAAAAGG - Intergenic
919178457 1:194050384-194050406 TTTCAGAAGAAAAAAGAGAAGGG + Intergenic
919543793 1:198885819-198885841 TATGGGAAGAAAAATGAAATGGG + Intergenic
919545055 1:198905547-198905569 TAACACTAGAAAAATGAGAATGG + Intergenic
919942980 1:202301080-202301102 TAGGAGAAGAAAGCAGAGATTGG + Intronic
920080542 1:203369634-203369656 CAGGAGAGGAAAAATGACAAAGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920608426 1:207413112-207413134 TAGGAGAAGGAAAATAAACAAGG + Intergenic
920881659 1:209886555-209886577 GATCAGAAGAAAAAAGAGAAGGG + Intergenic
920942806 1:210499889-210499911 CATGAGAATAAAACTGAGAAAGG + Intronic
921026660 1:211290089-211290111 TAGGAAAAGACAACTAAGAAAGG - Intronic
921285925 1:213609355-213609377 TAGGAGACCAGAAGTGAGAAAGG - Intergenic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921510782 1:216026193-216026215 TATGAGAGGAAAACTGCGAATGG - Intronic
921538401 1:216381722-216381744 TAGCAGGAGAAAACTGAAAAAGG - Intronic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
921768449 1:219003102-219003124 TAGAAGAAGAAAAAAGTGACAGG - Intergenic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
922193342 1:223339073-223339095 TAGAGGAAGAAAAAGCAGAAGGG + Intronic
922493160 1:226034910-226034932 TATCAGAAGAAAAAGCAGAAGGG - Intergenic
922521854 1:226260016-226260038 TAGGCTAAGAAAAAAGAGAGAGG + Intronic
922877522 1:228951632-228951654 CAGGAGAAGAAAATTCACAATGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923378675 1:233392648-233392670 AAGGAGAAGGAAAAGGAAAAGGG - Intergenic
924010743 1:239662951-239662973 GAGGAGAAGGAAGAGGAGAAAGG - Intronic
924053702 1:240103589-240103611 TAGGAAAAGAAAAGAGAAAATGG - Intronic
924107157 1:240660474-240660496 TAGGAAAACAAAAATGAATAAGG + Intergenic
924485059 1:244474717-244474739 AAGAAGAAGAAAAAAAAGAAGGG - Intronic
924918193 1:248596446-248596468 CAGGAGAACAAAAGTGAGAGTGG + Intergenic
1062956734 10:1545436-1545458 AAGTAGAACAGAAATGAGAATGG + Intronic
1062991999 10:1828105-1828127 TAGGAGAAGTAAAATCAAAATGG + Intergenic
1063604514 10:7510542-7510564 TTGGAGAATAAACCTGAGAAGGG + Intergenic
1063710906 10:8477425-8477447 TAAGACAAGAAAAATGAATATGG - Intergenic
1064067554 10:12195702-12195724 GAGGAGAAGAAGAAGGGGAAAGG - Intronic
1064513705 10:16123435-16123457 TAGTAGGAGAAAAGTGAAAATGG - Intergenic
1064917624 10:20478873-20478895 TAGAAGAAGAAGGATAAGAAAGG + Intergenic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065665997 10:28061582-28061604 AAGGAGAGGAAAAAAGAGATTGG + Intronic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1065736594 10:28758684-28758706 CAGTAGAAGAAAAATGGTAAGGG + Intergenic
1065850113 10:29780792-29780814 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1066065984 10:31761128-31761150 GAGGAGAAGGAAGAAGAGAAAGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066511308 10:36099768-36099790 AAGGAGAAGGAAAATGATATAGG + Intergenic
1066534627 10:36378002-36378024 TAGTAGAACACAAAAGAGAAAGG - Intergenic
1066550163 10:36547229-36547251 TAGGTCAAGAAAGATGAAAATGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1066744786 10:38597056-38597078 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1066750890 10:38655708-38655730 TACAAAAATAAAAATGAGAAAGG + Intergenic
1066780286 10:38938233-38938255 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1066984977 10:42456817-42456839 TAAAAGAAGAATAATGATAAAGG + Intergenic
1067055607 10:43048187-43048209 TGGTAAAAGAAAAATGAAAACGG - Intergenic
1067757936 10:49019336-49019358 AAAGAGGAGAAAAATGTGAAGGG + Exonic
1068001691 10:51342213-51342235 TAGGATAAGTAATAGGAGAAGGG + Intronic
1068316091 10:55344449-55344471 TAGGACCAGAACAATGAGAAGGG + Intronic
1068410794 10:56651713-56651735 CAGGAGAATAAAAGTGGGAAAGG - Intergenic
1068434901 10:56977891-56977913 TAGGAGAAGAAAGATCCAAAGGG + Intergenic
1068631237 10:59299974-59299996 TGGCAGAAGAAAAATGAGACTGG + Intronic
1068761874 10:60721280-60721302 CAGGAAGAGAAAAATGAGAATGG + Intronic
1068847489 10:61694791-61694813 TAGGAGAACAAAAATTGGAGGGG + Intronic
1069021719 10:63495767-63495789 AAGAAGAAGAAAATTGAGAAAGG + Intergenic
1069113645 10:64477008-64477030 TGTGTGAAGAAAAATGAAAAAGG - Intergenic
1069200164 10:65604302-65604324 GAGGAGGAAAAAAATGAAAAAGG + Intergenic
1069351551 10:67532701-67532723 AAGGAGAAGAAAGATGGGACAGG + Intronic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1069966340 10:72120466-72120488 CAGGAGAAGAAAAAAAGGAATGG + Intronic
1070225201 10:74496969-74496991 AAAGAGAAAAAAAATGAGAGAGG - Intronic
1070421275 10:76239541-76239563 GAGAAGATGAAAAAGGAGAAGGG - Intronic
1071124953 10:82323012-82323034 AAGGAGAAGAAAAAGGAAAAAGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071421677 10:85506271-85506293 TAGGTTAAGAAAATTGAGATGGG + Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072825749 10:98604526-98604548 TAGAAGGAGAAGAAAGAGAAAGG + Intronic
1072875891 10:99172884-99172906 AAGAAGAAGAAAAAGAAGAAAGG + Intronic
1073539161 10:104304205-104304227 AAGAAGAAGATAAATGAAAATGG - Intronic
1073748233 10:106494270-106494292 GAGGAGAAGAAAAAAGAAAAAGG - Intergenic
1073998856 10:109346823-109346845 TATTAGAAAAACAATGAGAATGG - Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074460441 10:113631924-113631946 TGGGAGAAGACAAAGGGGAAAGG - Exonic
1074835018 10:117283126-117283148 TGTAAGAACAAAAATGAGAAAGG - Exonic
1075168069 10:120087256-120087278 CAGGGAAAGATAAATGAGAATGG + Intergenic
1075371647 10:121941210-121941232 TAGGAGTAGAAAAATTAGCCGGG + Intergenic
1075452872 10:122564922-122564944 AAAGAGAAGAAAACTGACAAGGG - Intronic
1075532678 10:123243308-123243330 TAGAAGAAAATAAATCAGAAGGG + Intergenic
1075833653 10:125433645-125433667 GAGGAGGAGAAAATAGAGAAGGG - Intergenic
1075934129 10:126325138-126325160 TATGAGAAGAAACATGAGAACGG + Intronic
1076073500 10:127513092-127513114 TAGGAAAAGAAAAAAGAATATGG + Intergenic
1076330379 10:129660135-129660157 AGGGAGATGAAAAATCAGAATGG - Intronic
1076446753 10:130519559-130519581 TAGGAGCAAGAAAAAGAGAAAGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077726824 11:4683105-4683127 CAGGGAAAGTAAAATGAGAAAGG - Intronic
1077759265 11:5073436-5073458 AACGATAAGAATAATGAGAAAGG + Intergenic
1078327142 11:10389853-10389875 AAGGAGAAGAACAAAGAAAATGG - Intronic
1078495301 11:11811348-11811370 TAGGTGTAGAACAAGGAGAAAGG + Intergenic
1078903912 11:15666727-15666749 AAGCAGATTAAAAATGAGAATGG - Intergenic
1078910281 11:15724623-15724645 GAGGAGCAGAAAAGGGAGAAGGG + Intergenic
1079404108 11:20130030-20130052 TAGCAGAAGAAAAAGGAAAAAGG + Intergenic
1079589703 11:22167373-22167395 TAAAAGAAGAACAATGGGAAAGG - Intergenic
1079665511 11:23100036-23100058 TATGAGAAGAAAAAGAATAATGG - Intergenic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1079788739 11:24709477-24709499 AAGGAGAAGCTAAAAGAGAAAGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079990827 11:27244831-27244853 CAGGATAAGAAAGATGAGAGAGG + Intergenic
1080257567 11:30308179-30308201 TAGAAGATGAGAAATGAGATTGG - Intergenic
1080263510 11:30376208-30376230 TAGAGGAAGAAAGAGGAGAAAGG + Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080445835 11:32336238-32336260 CAGTAGAAGAAAAATGGGCAGGG - Intergenic
1080827745 11:35862028-35862050 TAGGAGAAGAAACCCCAGAAAGG + Intergenic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081157134 11:39707067-39707089 TACAATGAGAAAAATGAGAAGGG - Intergenic
1081340302 11:41919371-41919393 TAGAAGAAGAAAAATGATTTAGG - Intergenic
1081434527 11:43012406-43012428 GATGAGATGAAGAATGAGAACGG + Intergenic
1082094629 11:48119370-48119392 CAGGAGAATAAACAAGAGAAAGG - Intronic
1082207166 11:49451675-49451697 TAGGAGAATAAGAATTAGAAAGG - Intergenic
1082220305 11:49627109-49627131 TGGGAGAAGAAAAATATGAGAGG - Intergenic
1082923012 11:58516206-58516228 AAGGAAAAGAAAAATTAGCAGGG + Intergenic
1082965456 11:58962423-58962445 TAGGAGAAGATAAAAGGGAGAGG + Intronic
1082991840 11:59213300-59213322 TAGTAAAAGAAAACTGATAATGG - Intergenic
1083319678 11:61838109-61838131 GAGGAGAAGGAAAATGAAACTGG - Intronic
1084018781 11:66404507-66404529 GAGGGGAAGAAAAGTGAAAAGGG - Intergenic
1084292199 11:68180556-68180578 TAACAGTAGAAAAATGAGTAAGG + Intronic
1084469698 11:69351409-69351431 TAGCAGAATGGAAATGAGAAAGG - Intronic
1085329222 11:75633811-75633833 TAGGAGAAGAGATCAGAGAAGGG + Intronic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1085844829 11:80053068-80053090 AAGGGGAAGCAAAATCAGAATGG + Intergenic
1085871877 11:80359766-80359788 GAGGAGGAGGAAAAAGAGAAGGG + Intergenic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086077460 11:82869719-82869741 TATAAAAACAAAAATGAGAATGG + Intronic
1086138601 11:83468792-83468814 GAAGAGAAGATAGATGAGAAGGG - Intronic
1086195003 11:84127360-84127382 TAGCAGAAGAAGGATTAGAAAGG - Intronic
1086475729 11:87171078-87171100 TAGGAGAAACAATATGAAAAGGG + Intronic
1086502241 11:87465328-87465350 CAGGATAATAAAATTGAGAATGG + Intergenic
1086629356 11:88998036-88998058 CAGGAGAAGAAAAATATGAGAGG + Intronic
1086648110 11:89250061-89250083 TAGGAGAATAAGAATTAGAAAGG + Intronic
1086657560 11:89378701-89378723 TAGGAGAATAAAAACGTCAAAGG + Intronic
1087301784 11:96444266-96444288 TGGGAGAAGAAAGAGAAGAATGG - Intronic
1087394631 11:97581872-97581894 TATCAGAAGAAGAAAGAGAATGG + Intergenic
1087427150 11:98004246-98004268 TGTGAGAAGAAAAAGAAGAAAGG - Intergenic
1087524599 11:99293924-99293946 TAGAAGGAAAGAAATGAGAAAGG - Intronic
1087826837 11:102774463-102774485 TTGATGAAGAAAAAAGAGAAAGG + Intronic
1087930682 11:103974105-103974127 TAGAAGAAGAAAGAGGAAAAAGG + Intronic
1087957367 11:104304946-104304968 GAGGAGAAGGGAAAAGAGAAAGG - Intergenic
1087982580 11:104634361-104634383 TAGAAGGAAAAGAATGAGAAAGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088115235 11:106305174-106305196 AAGGGGAAGAAAAAAGACAAGGG + Intergenic
1088345984 11:108825611-108825633 TAGGTGAACATGAATGAGAATGG - Intronic
1088433849 11:109788968-109788990 GAGAACAAGAAAAATGAAAATGG - Intergenic
1088806866 11:113360531-113360553 TTGAATAAGAAAACTGAGAAAGG + Intronic
1088850373 11:113699030-113699052 TTAGAGAAGAACAAAGAGAAAGG + Intronic
1089474909 11:118751803-118751825 AAGGAAAAGAAAGAAGAGAAGGG - Exonic
1089646316 11:119881943-119881965 TAGGCAAAAAAAAATGAGCATGG - Intergenic
1089646482 11:119883617-119883639 TAAGAGAAGAAAAAGAAGAATGG - Intergenic
1089863784 11:121614107-121614129 AAGAAAAAGAAAAGTGAGAAGGG - Intronic
1090357884 11:126152220-126152242 CAGGAGAAGAATATAGAGAAAGG - Intergenic
1090428425 11:126626558-126626580 TAGCAGGAGAAACATGAGTAAGG + Intronic
1090440209 11:126719038-126719060 GAGGAAAACAAACATGAGAAAGG - Intronic
1090478561 11:127047194-127047216 TGGATGAAGAGAAATGAGAAGGG + Intergenic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090717216 11:129441138-129441160 TGGGACAAGTAGAATGAGAAAGG - Intronic
1090747781 11:129721058-129721080 GGGGAGAGGAAAAATGAGAGGGG - Intergenic
1090991672 11:131822749-131822771 TAGGATAGGGCAAATGAGAAAGG + Intronic
1091066006 11:132513597-132513619 TAAGAGAAGAGACATGAAAATGG - Intronic
1091066560 11:132518987-132519009 TTAGAGAATAAATATGAGAATGG - Intronic
1091077515 11:132634049-132634071 TAGCAGAAGCAAAAAGGGAAAGG + Intronic
1091720002 12:2806016-2806038 TTGGAGAAAAAATATGTGAAAGG + Intergenic
1091879255 12:3963468-3963490 GAGGAGAGGAAAAGTGAGTAGGG + Intergenic
1092033720 12:5311965-5311987 TAGGAGAAAAAGAGTGTGAATGG - Intergenic
1092067425 12:5603493-5603515 TGGTAGAAGAAGAAAGAGAAAGG + Intronic
1092517351 12:9228704-9228726 TAGTAAAAGAAAAGGGAGAAAGG + Intergenic
1092519164 12:9249206-9249228 TAAAAGAAAAGAAATGAGAATGG + Intergenic
1092800587 12:12161961-12161983 TAGGTGAAGAAAGAGGGGAATGG - Intronic
1092963482 12:13618422-13618444 TAAGAGAAAAAAAATCAAAAGGG - Intronic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093092620 12:14938347-14938369 TAGGAGAAGGAAAGGGAGCATGG - Intronic
1093102602 12:15046016-15046038 AATGAGAAGAAAAATAATAAAGG - Intergenic
1093239099 12:16647057-16647079 TAGGTGAAGAAAGATGGTAATGG + Intergenic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093373946 12:18400585-18400607 GAGGAGAAGAAAGGTGGGAAAGG + Intronic
1093398107 12:18708154-18708176 AGGGAGAAGAAAATGGAGAAAGG - Intronic
1093711848 12:22336290-22336312 TTGAGGAAGAAAAATGGGAATGG - Intronic
1093747741 12:22762273-22762295 TAAGAGTGGAGAAATGAGAAAGG - Intergenic
1093775334 12:23067157-23067179 GAGGAGAAGGAAGAAGAGAAAGG - Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1093859056 12:24141200-24141222 TAGGAGAAGAAAGATGTAAAAGG - Intergenic
1094126577 12:27029970-27029992 TAGCAGAAGGAAACTTAGAATGG + Intronic
1094144557 12:27214821-27214843 TATGAGAAGGAAAAAAAGAAGGG + Intergenic
1094211578 12:27898908-27898930 TAGGAGGAGAAAAATTGAAATGG - Intergenic
1094213335 12:27915640-27915662 TAGGAAAAGAAGTATGAGAATGG - Intergenic
1094476057 12:30841656-30841678 TTGGAGACGAAAAATAAAAAAGG + Intergenic
1094478995 12:30865347-30865369 TATAAGAAGAAACATGAGCAAGG - Intergenic
1094644660 12:32310915-32310937 TAGGAGAAGAAAAGGCCGAAAGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095275910 12:40282142-40282164 AAGGGGAAGAGAAAGGAGAAGGG - Intronic
1095376471 12:41535137-41535159 TAACAGAAGAAATATGAGAAGGG - Intronic
1095504160 12:42875063-42875085 TAGAAGAAAACAAAGGAGAAAGG - Intergenic
1095545625 12:43364685-43364707 AAGAAGAAGAAAAATGAATAGGG + Intronic
1095611108 12:44129011-44129033 AAGTAGAAGAATAATCAGAATGG - Intronic
1095620883 12:44252167-44252189 TAGGTGGAAAAAAAGGAGAAAGG - Intronic
1095917659 12:47496318-47496340 AAAGAGAAAATAAATGAGAAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096886141 12:54721273-54721295 GAGGAGAAGAAAAAGAAGAGAGG - Intergenic
1096887290 12:54730691-54730713 AAAGAAAAGAAAAAAGAGAAGGG - Intergenic
1097284401 12:57866326-57866348 CAGGAAAAGAAAAATATGAAGGG - Intergenic
1097307102 12:58081435-58081457 TGGTAGAAGAAAAAAGAGCATGG + Intergenic
1097980304 12:65731225-65731247 CAGGAGAAAAAAAAAGAAAAAGG + Intergenic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1098586308 12:72157881-72157903 AAAGAGAAGAACATTGAGAAAGG + Intronic
1098586430 12:72160098-72160120 TAGCAGAGGAAAAAGAAGAAAGG - Intronic
1098610358 12:72449892-72449914 TAGAAGGAGAAAAGTGAGGAAGG - Intronic
1098621970 12:72612279-72612301 TAGGGAAAGAAGAATTAGAAGGG - Intronic
1098705343 12:73681329-73681351 AAGAAGAAAAAAAATGAGATGGG - Intergenic
1099028190 12:77491987-77492009 AAGGAGAAAAAATATGAGATAGG - Intergenic
1099031691 12:77533666-77533688 AAGGAGAGGGAAAAAGAGAAAGG + Intergenic
1099718969 12:86336732-86336754 GAAGACAAGAAAAATCAGAATGG + Intronic
1099740267 12:86625772-86625794 TAGGAAAAGTAAAATGGAAATGG + Intronic
1099870111 12:88336854-88336876 AAAAAGGAGAAAAATGAGAAAGG + Intergenic
1099896840 12:88659042-88659064 TAGGAAATAAAAAATGAGAAGGG - Intergenic
1099908373 12:88799340-88799362 TATGAGAAAAAAGATGATAAGGG - Intergenic
1099964686 12:89433194-89433216 TGGGAGAAGAGCAATGAGACAGG + Intronic
1100059254 12:90552768-90552790 TAGGGTAAGAAAAGTAAGAATGG + Intergenic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1100695722 12:97090576-97090598 TAGGAAAAAATAAATGAGCATGG + Intergenic
1100913583 12:99392335-99392357 GAGGAGAACTAAAATTAGAATGG - Intronic
1101064527 12:101005885-101005907 TAGGGGAAAAGAAAGGAGAAAGG - Intronic
1101322432 12:103684397-103684419 TGATAGAAGAAAAATGAGGAGGG + Intronic
1101324847 12:103706516-103706538 AGGATGAAGAAAAATGAGAAAGG - Intronic
1101348923 12:103910139-103910161 TAAGAGCTGGAAAATGAGAATGG + Intergenic
1101610016 12:106282806-106282828 TAGGAGGAGAAAATTGAGGCTGG - Intronic
1101821547 12:108188139-108188161 TTGGGGAAGATAAATGAAAATGG + Intronic
1101887938 12:108684647-108684669 AAGGAGAAAATAAATAAGAATGG + Intronic
1102397979 12:112603787-112603809 AGGGCGAAGAAAAATGAGACTGG - Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102559505 12:113752294-113752316 TAGGGGGACAAAAAAGAGAATGG + Intergenic
1102624402 12:114223169-114223191 AATGAAAAGCAAAATGAGAAGGG - Intergenic
1102689560 12:114749779-114749801 CAGCAGAAGAAAAAAGAAAAGGG + Intergenic
1102754128 12:115323140-115323162 AAAGAAAAGAAAAAAGAGAAGGG + Intergenic
1102848813 12:116218627-116218649 TTGGAGAAGAAATTTGAAAATGG - Intronic
1103132700 12:118482781-118482803 TAGAAGAGGGGAAATGAGAAGGG + Intergenic
1103133613 12:118489064-118489086 TTGGAGAATAAAACTGAGAGGGG + Intergenic
1103256038 12:119542334-119542356 AAGAAGAAGAAAAAGGACAAAGG + Intergenic
1103290248 12:119839782-119839804 TAGGAGAAGAAAAATAAACTTGG + Intronic
1103317280 12:120066338-120066360 GAGGAGAAGGAAAATAAGTATGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105286504 13:19008747-19008769 TAGGAGGAGGAACAGGAGAACGG - Intergenic
1105544861 13:21343982-21344004 GAGGAGGAGAAGAAGGAGAAGGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1105809436 13:23981268-23981290 TAGGAAAAAAAAAATGTCAAGGG + Intronic
1105828464 13:24143319-24143341 TGGGAGAAGTAAAATGAGAAAGG - Intronic
1105962645 13:25356052-25356074 TTGATCAAGAAAAATGAGAACGG - Intergenic
1105979958 13:25508911-25508933 TAACAGAAGAAGGATGAGAAGGG - Intronic
1106369758 13:29120620-29120642 TAAGAGAAGAATAAAAAGAAAGG + Intronic
1106422153 13:29593758-29593780 TAGGTGAAAAAAAAAAAGAAAGG - Intronic
1106662033 13:31809858-31809880 CAGAAGAAGAAAAAAGACAAGGG + Intergenic
1106733094 13:32562119-32562141 TATAAGAAGAAATATGAGAGAGG + Intergenic
1106775881 13:33009122-33009144 AAGGTTAAGGAAAATGAGAATGG - Intergenic
1106810129 13:33350659-33350681 GAGGAGAAGGAAAGTGGGAAAGG - Intergenic
1106872782 13:34039637-34039659 AAGAAGAAGGAAAAAGAGAAGGG - Intergenic
1106885564 13:34181203-34181225 AAGGAAAAGAAGAAAGAGAAAGG - Intergenic
1107189967 13:37569823-37569845 TATGAGAAGGACAATGAAAAAGG + Intronic
1107220909 13:37978824-37978846 GAGGAGAGGAGAAAGGAGAAAGG + Intergenic
1107586758 13:41857937-41857959 GAGTAGAACAAAAAGGAGAAAGG + Intronic
1107743906 13:43485174-43485196 TAGCTGACTAAAAATGAGAATGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108033292 13:46259424-46259446 TAGCAGGAGAAAAATGACATAGG + Intronic
1108149582 13:47519468-47519490 CAGAAGAAGTCAAATGAGAATGG - Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108629285 13:52265507-52265529 TGGGAGCTGAATAATGAGAATGG + Intergenic
1108656769 13:52540972-52540994 TGGGAGCTGAATAATGAGAATGG - Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109445751 13:62437546-62437568 TAGGAAGAGAAACATCAGAAAGG - Intergenic
1109526754 13:63585754-63585776 TATGAGAAGAAAAGTGAAAGAGG - Intergenic
1110312730 13:74069734-74069756 TAGAAGAAGAATATTAAGAAAGG + Intronic
1110465551 13:75796812-75796834 AAGGAGAAGAAAAAGAAGAGAGG - Intronic
1110665766 13:78115993-78116015 AAGGAGAAGAAAAAGCAAAAGGG - Intergenic
1110840820 13:80141110-80141132 TGGAAGAATAAAAATGCGAAGGG + Intergenic
1110870219 13:80443539-80443561 AAGGAGGAGAAAAAGAAGAAAGG - Intergenic
1110904441 13:80867860-80867882 AAGGAGAAAATAAAGGAGAATGG + Intergenic
1111007468 13:82266700-82266722 TATATGAAGAAAAATGAAAATGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111147710 13:84206082-84206104 TTTGAGAAGAAGAATGGGAAAGG + Intergenic
1111217718 13:85165564-85165586 TAGGAGAAAAACAGAGAGAAGGG - Intergenic
1111286831 13:86104838-86104860 GAGAAAAAGAAAAATGATAAAGG - Intergenic
1111434109 13:88184044-88184066 TAAGAGAAGAATAATGGAAAAGG + Intergenic
1111626955 13:90800103-90800125 TAGGAAATGAAAAATGTGAATGG - Intergenic
1111709314 13:91791567-91791589 TATGGGCAGAAATATGAGAATGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112289261 13:98130595-98130617 AAGGAAAAGAGAAAAGAGAAGGG + Intergenic
1112428789 13:99331225-99331247 CAGAAGAAAAAAAATAAGAAAGG - Intronic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1112728075 13:102328035-102328057 TATGAAAAGAAAAATGAAAGTGG + Intronic
1112795879 13:103056307-103056329 TAGGAAAAGAGAAAAGAAAACGG - Intronic
1113368946 13:109705386-109705408 AAGGAGAGGAAAAATGGGAGGGG + Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1114207020 14:20581611-20581633 TAGGAGAAGGAAGCTGAGGATGG - Intergenic
1114691795 14:24589720-24589742 AAGGAAAAGAAAAAAAAGAATGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115137181 14:30124651-30124673 CAGGAGTACAAAAATGAAAATGG + Intronic
1115272046 14:31563462-31563484 TAACAGAAAAAAAGTGAGAAAGG - Intronic
1115275601 14:31605813-31605835 GAGGAGACGAGAAAGGAGAAGGG - Intronic
1115425235 14:33251222-33251244 TAAGAAAAGAAAAAGGAAAACGG - Intronic
1115461495 14:33666034-33666056 CTTGAGAAGAAAAATGAGATAGG + Intronic
1115473504 14:33792398-33792420 TGTGAGAAAAAAAAGGAGAATGG + Intronic
1115497825 14:34024544-34024566 GAGGAGAAGAGAAGGGAGAAGGG - Intronic
1115667671 14:35570912-35570934 TAGGACAATAAAAATGTCAAAGG + Intronic
1115720067 14:36151007-36151029 AGGGAGAAGAAAAATGATATAGG - Intergenic
1115762254 14:36586321-36586343 TAGCAAAAGGAAAATGAAAATGG + Intergenic
1115886569 14:37978302-37978324 TAGGAAAAGAATAAGGAAAAGGG + Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116276392 14:42839058-42839080 TAAGGGAAGAATCATGAGAAAGG + Intergenic
1116345968 14:43794526-43794548 TATATGAAGAAAAATGAAAAGGG - Intergenic
1116413829 14:44657017-44657039 GAGGAGAAGACAAATGTAAATGG - Intergenic
1116529891 14:45957096-45957118 CAGGAGAAGACAAAGGATAAGGG + Intergenic
1116596564 14:46855882-46855904 TTTTAGAAGAAAAATGAGACAGG - Intronic
1116890435 14:50262649-50262671 TATGAAAATAAAAATGAGCAGGG - Intronic
1117009965 14:51460892-51460914 TACTAAAAGAAAAATGAAAAAGG - Intergenic
1117109993 14:52442560-52442582 AATTAGAAGAAAAATGAGAATGG - Intronic
1117219891 14:53592741-53592763 TAGGAGGTGAATAAAGAGAATGG + Intergenic
1117466815 14:56001993-56002015 TAGGAAGAGAAAAATAATAAAGG - Intergenic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1117849770 14:59955493-59955515 TAGAACAATAAAAATGATAAAGG - Intronic
1118022274 14:61729738-61729760 TAGTGGAGCAAAAATGAGAAAGG + Intronic
1118264646 14:64283422-64283444 TAAGAGAAGATCAATGAGCAAGG + Intronic
1118563727 14:67116332-67116354 AAGGAAAAGAAAAAGGGGAAGGG + Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1119016672 14:71064391-71064413 TAGCAGCAGAATAAGGAGAATGG - Intronic
1120282305 14:82454759-82454781 AAGGAAAAGAAAAAAAAGAAAGG - Intergenic
1120581601 14:86257144-86257166 TAAAAGGAGAAAAATGACAAGGG - Intergenic
1120633704 14:86925267-86925289 CAGATAAAGAAAAATGAGAAGGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1121126271 14:91408769-91408791 TAGGGGAAGAAACACGAGAATGG + Intronic
1121190964 14:92029725-92029747 GAAGAGAAGAAAACTGACAAAGG + Intronic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121345529 14:93132945-93132967 TAGGGGAAAAAAAATCAAAAGGG + Intergenic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121593270 14:95137180-95137202 AAGGAGAAGGAAAAGGGGAAGGG + Intronic
1121748413 14:96322563-96322585 TACGAGAAGAAAAAGGAGATGGG + Exonic
1122802085 14:104236266-104236288 TTTGAGAAGAAACAAGAGAAGGG - Intergenic
1122964455 14:105115509-105115531 GAGGAGAAGAAAACTGCGTATGG + Intergenic
1123453303 15:20388254-20388276 TAGTATAAGAAAAATGAGGGTGG + Intergenic
1124598430 15:31110921-31110943 GAGGAGCAGAAAAAGCAGAAGGG - Intronic
1124985043 15:34600094-34600116 TATGAACAGAAATATGAGAATGG - Intergenic
1125363159 15:38886189-38886211 TAGGAGTGGAAATAAGAGAAAGG - Intergenic
1125792703 15:42381254-42381276 AGGGAGAAGAAAAATGATACAGG - Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126390459 15:48144169-48144191 GAGGAGAAAAAAAAGGAGAAAGG + Intronic
1126392628 15:48176486-48176508 CAGGAAAAGAGAAAGGAGAAAGG - Intronic
1126438150 15:48657035-48657057 GAGGAGGAGAAAGATGCGAATGG + Intergenic
1126822789 15:52521326-52521348 TAGGAGAAGTAAAATGATCAGGG - Intronic
1126966833 15:54063544-54063566 TAGGAGAATAAAAATGAGTGAGG - Intronic
1127013541 15:54656845-54656867 TAAGAGTACAATAATGAGAAAGG - Intergenic
1127170214 15:56293174-56293196 TATGAAAAAAAAAATGAGCAGGG + Intronic
1127574595 15:60278747-60278769 TATGAGAAGAAAGATGAGCAGGG - Intergenic
1127997879 15:64164365-64164387 TAGGAGAAAAAAAAAAAAAAGGG - Intergenic
1128485706 15:68085371-68085393 TAGGTGGGGAAAAAGGAGAAAGG + Intronic
1128719531 15:69937695-69937717 TAGGAGAAAGAAAATAATAAAGG + Intergenic
1129422081 15:75436612-75436634 TAGTAGTAGAAAAATGATAATGG + Intronic
1129459557 15:75693694-75693716 TAGGAGAAGGAATCTGAGCAGGG - Intronic
1129543007 15:76366612-76366634 TAGGAAAAGAAACTGGAGAATGG - Intronic
1129602915 15:77010625-77010647 AAAGAGAAGAAAAGTGAGAGAGG - Intronic
1129765040 15:78159297-78159319 TGGGGGAAGAAAAAGGAGGAGGG - Intronic
1129916716 15:79280657-79280679 AAGGAGATGAAAAATTATAAAGG + Intergenic
1129950157 15:79579353-79579375 AATGAGAAGATAAATGAGAAGGG - Intergenic
1129987709 15:79933277-79933299 TCAGAGAAGAAAAATTTGAACGG + Intergenic
1130032691 15:80329743-80329765 TAGGAGAAAAAAATGGATAAAGG + Intergenic
1130091597 15:80825646-80825668 GAGGAGAACAAAAGTGAGAGAGG + Intronic
1130147653 15:81286733-81286755 CATGAGAAGAGAAAAGAGAAGGG + Intronic
1130272432 15:82458989-82459011 TAGGAGAAGGAATCTGAGCAGGG + Intergenic
1130464782 15:84186342-84186364 TAGGAGAAGGAATCTGAGCAGGG + Intergenic
1130487904 15:84408462-84408484 TAGGAGAAGGAATCTGAGCAGGG - Intergenic
1130499484 15:84487195-84487217 TAGGAGAAGGAATCTGAGCAGGG - Intergenic
1130587075 15:85190956-85190978 TAGGAGAAGGAATCTGAGCAGGG + Intergenic
1130822226 15:87507803-87507825 TAGGAGCAGAAAGAAGAGCAGGG - Intergenic
1131366012 15:91840745-91840767 AAGGACAACAAAAATGGGAAAGG - Intergenic
1131671796 15:94627490-94627512 CAGGAGAAGAAAAAGTTGAAGGG + Intergenic
1131701663 15:94943097-94943119 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131701670 15:94943134-94943156 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131875105 15:96797525-96797547 TATGAGGGGAAAAATGACAAGGG - Intergenic
1133543747 16:6785185-6785207 CTGGAGAAAAAAAATGACAAAGG + Intronic
1133611247 16:7435445-7435467 AAAGAGAGGAAAAATGAGACAGG - Intronic
1133812170 16:9169096-9169118 TAGAAGAAGAGAAATGAGATGGG - Intergenic
1133914485 16:10096757-10096779 TAGGGGAAGTACAAGGAGAATGG - Intronic
1133974211 16:10588905-10588927 TAGGAGAAGAATAATCCAAAGGG + Intergenic
1134869849 16:17642238-17642260 TAGGGGAAGAGAAATGAAATGGG + Intergenic
1135375964 16:21947761-21947783 TAAGGGAAGAATCATGAGAAAGG - Intergenic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1136481115 16:30542427-30542449 TAGGAAAAGAAAAATGGTTATGG + Intronic
1136698710 16:32112041-32112063 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1136768894 16:32815788-32815810 AAAGAAAAGAAAAAGGAGAAAGG + Intergenic
1136799215 16:33055340-33055362 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1136901699 16:34046567-34046589 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1136931120 16:34418718-34418740 TGGGAGAACAAAAATGGGAGAGG - Intergenic
1136956892 16:34798287-34798309 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1136973453 16:34993090-34993112 TGGGAGAACAAAAATGGGAGAGG + Intergenic
1137373052 16:47926624-47926646 TAGTAGCAGAAACATGAGAAGGG + Intergenic
1137377251 16:47962801-47962823 TAGAACAAGAAAAATGAGACTGG + Intergenic
1137422389 16:48346607-48346629 TTTGAAAAGAAAAGTGAGAAGGG - Intronic
1137855250 16:51788338-51788360 TAGGATTAGAAAAATGGGAATGG + Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138467644 16:57203697-57203719 TAGGAGAATAAAGATGAGTAAGG - Intronic
1138509003 16:57497194-57497216 TAGGAGAGGTTAAATGAGGATGG + Intergenic
1138746617 16:59370028-59370050 TAGAATAAAAAAAATCAGAAAGG + Intergenic
1138937607 16:61748711-61748733 TGGGAGAAGAAAATAGAGAAAGG - Intronic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139166810 16:64576042-64576064 TAGGATAGAAAAAATGTGAATGG - Intergenic
1139813606 16:69646341-69646363 TAGGAGAATCAAGATGAAAAAGG - Intronic
1139972646 16:70785884-70785906 GAGGAGAAGACAGATCAGAATGG + Intronic
1140235856 16:73158007-73158029 CAGGAAAAAAAAAATGAGACAGG + Intergenic
1140317248 16:73911021-73911043 GAGGAGAGAAGAAATGAGAATGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140950772 16:79815334-79815356 TGGGTGAAGAAAAATGGAAAGGG + Intergenic
1141022096 16:80507118-80507140 GAGGAGAAGAAAATGGAAAAGGG + Intergenic
1141278951 16:82613379-82613401 TTGTAAAAGAAAAATGAGACCGG + Intergenic
1141496256 16:84411965-84411987 AAGGAAAAGAAAGAAGAGAAAGG - Intronic
1141544148 16:84752465-84752487 TAAAAGAATAAAAATGAGGAAGG - Intronic
1203071311 16_KI270728v1_random:1077899-1077921 AAAGAAAAGAAAAAGGAGAAAGG + Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142935037 17:3322224-3322246 TAGATGAATAAAAATGAAAAAGG - Intergenic
1143873461 17:9974445-9974467 TGGGGGAAGAAAAATGAAATTGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144244743 17:13351947-13351969 AAGGAGAAGTAAAAGGAAAAGGG - Intergenic
1144262491 17:13536130-13536152 TGGGAGATGACAAATGAGAATGG - Intronic
1144420263 17:15091128-15091150 TAGAAGAAGAAAAGAAAGAAAGG + Intergenic
1144498438 17:15765091-15765113 CAGGAGCTGAAAAAGGAGAAAGG - Intergenic
1144603479 17:16641251-16641273 AAGAAAAAGAAAAGTGAGAAGGG - Intronic
1145004143 17:19327787-19327809 TAGAAGGAGAAACAAGAGAAAGG + Intronic
1145030047 17:19497920-19497942 TTTGAGAGGAGAAATGAGAAAGG + Intronic
1145161820 17:20580132-20580154 CAGGAGCTGAAAAAGGAGAAAGG - Exonic
1145179043 17:20728788-20728810 CAGGAGAAAAAAAAAAAGAATGG - Intergenic
1145692865 17:26762291-26762313 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1145982714 17:29023330-29023352 TTGGGGAAGAATAATGAGATTGG + Intronic
1146138102 17:30340872-30340894 TCAGAGAAGAGAAAAGAGAATGG + Intergenic
1147039107 17:37703699-37703721 TGGCAGAAGGAAAATGGGAATGG - Intronic
1147200001 17:38794793-38794815 TACCATAAGAAAAATGAAAAAGG + Intronic
1147305709 17:39562835-39562857 AAGGAGGAAAAAAATGAGAGAGG - Intronic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1147800202 17:43079962-43079984 AAGGAGAAAAAAAAGCAGAAAGG - Intronic
1148211850 17:45813386-45813408 GAGGAGAAGCCAAATGAAAAGGG - Intronic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148274018 17:46287513-46287535 AAGAAGAAGAAAACTAAGAAAGG + Intronic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149278318 17:55071091-55071113 AGGGAGAAGAAAAAGGAGATGGG - Intronic
1149749366 17:59130062-59130084 AAAGGGAAGAAAAAAGAGAAAGG + Intronic
1149896123 17:60429716-60429738 AAAGAGAAGAAAAAACAGAAAGG - Intronic
1149900077 17:60467922-60467944 TATGTAAAGAGAAATGAGAAGGG + Intronic
1149982607 17:61323274-61323296 GAGGAGAAGAATAATCAGAACGG - Intronic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150324478 17:64245670-64245692 TAGGATCAGAAAAGTGAAAAAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150901025 17:69277078-69277100 TAGGAGAACCTAACTGAGAAGGG + Intronic
1150937882 17:69657396-69657418 TTGGAGAAGATAACTCAGAATGG + Intergenic
1151092991 17:71463763-71463785 TATGAAAAGAAATATGAGATGGG - Intergenic
1151436825 17:74102849-74102871 GAGGAGAAGACAAAGAAGAAGGG + Intergenic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1152565126 17:81096954-81096976 GAGGAGGAGAAGAAGGAGAAAGG + Intronic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153153902 18:2127464-2127486 TAAGAGAAGAGAAATTGGAAAGG - Intergenic
1153367639 18:4276008-4276030 GAGGAGCAGAAAAAAGAGAGAGG + Intronic
1153580525 18:6569060-6569082 TAAGGGATGAAAAATGAGAAAGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154518667 18:15201833-15201855 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1154936470 18:21062963-21062985 GAGAAGGAGAAAAAGGAGAATGG + Intronic
1155512744 18:26593925-26593947 GAGGAGGAGAAAGAAGAGAAGGG + Intronic
1155540241 18:26862476-26862498 GAGGAGAACAAAAATAAGCATGG + Exonic
1156034432 18:32750967-32750989 TAGGAGAAAAAAAGAGAGAAAGG - Intronic
1156134265 18:34017771-34017793 ACGCAGAAGAAAAATCAGAAGGG - Intronic
1156173744 18:34517584-34517606 GAGGGGAAGAGAAATGAGCATGG - Intronic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157457014 18:47841065-47841087 TATGAGGACAAAAATGGGAATGG + Exonic
1157638418 18:49186406-49186428 TAGGAGAAGACAACAGGGAATGG - Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158031694 18:52973474-52973496 AGGGAGCAGAAATATGAGAAAGG - Intronic
1158242600 18:55393708-55393730 AAGGAAAACAAAAGTGAGAATGG + Intronic
1158270631 18:55711388-55711410 TGGGAGAACAAATATGAGAATGG - Intergenic
1158495404 18:57950821-57950843 TAGGAGTAGAAAGATGAGTAAGG + Intergenic
1158528760 18:58239351-58239373 TAACAGAAGAACAACGAGAAAGG - Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1158976249 18:62714494-62714516 AAGTAGAAGAAACATTAGAATGG - Intergenic
1159166470 18:64707762-64707784 TACAAGCAGAAAAATAAGAATGG - Intergenic
1159188778 18:65015061-65015083 TAGGAAAACAGAAATTAGAAAGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159461670 18:68728848-68728870 TAGTAAAAGAAAAAAGAGAAAGG + Intronic
1159467592 18:68804571-68804593 TAGGAGGAGAACCATGAGAGAGG + Intronic
1159506201 18:69339890-69339912 TAGAAAAAGAAGAATTAGAATGG + Intergenic
1159686782 18:71431586-71431608 TAGGAAAAGAATTCTGAGAAAGG - Intergenic
1160134220 18:76258726-76258748 TAGAAGAAAAAAAATAGGAAGGG + Intergenic
1161647589 19:5463381-5463403 AAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1162453807 19:10770298-10770320 TAAGAGTAAAAAAATGAAAATGG - Intronic
1162693573 19:12453535-12453557 TAGGAAAAAAAAAATAAAAATGG + Intronic
1162991587 19:14306349-14306371 AAGGAAAGGAAAAAGGAGAAAGG - Intergenic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1164324447 19:24179632-24179654 GAGGAGGATAAAAAGGAGAAGGG + Intergenic
1165024281 19:32948388-32948410 AAGGAGCAAAAAAGTGAGAAAGG + Intronic
1165474992 19:36025277-36025299 TGGGAGATGAACATTGAGAATGG + Intronic
1165545229 19:36529496-36529518 TTGGAGGACAGAAATGAGAAGGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165910275 19:39221713-39221735 AAGGAGAAGAAAAGTAAGTAAGG - Intergenic
1166553435 19:43682478-43682500 AAAGAAAAGAAAAAGGAGAAGGG + Intergenic
1166581396 19:43903172-43903194 AAGAAAAAGAAAATTGAGAAGGG + Intergenic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
1202682858 1_KI270712v1_random:25205-25227 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
925281011 2:2684696-2684718 TGGGAGAAAAAACATGAGAATGG - Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925818348 2:7775336-7775358 TAGGATGAGCAAAATGTGAAAGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926421017 2:12699410-12699432 AAGGGGGAGAAAAAGGAGAAGGG + Intergenic
926481996 2:13410978-13411000 TAGTATAAGAAAAATGAGGGTGG - Intergenic
926560795 2:14415283-14415305 TGGGGGTAGAAAACTGAGAAAGG + Intergenic
926788372 2:16543291-16543313 TAGGAGAGGAAGATTAAGAAGGG + Intergenic
926960823 2:18356696-18356718 TAAGAGAAGAAAAGAGAGGAGGG + Intronic
927050568 2:19324207-19324229 AAGAAGGAGAAAAATCAGAAGGG + Intergenic
927139614 2:20120729-20120751 AAGGAAAAGAAAAAAAAGAAAGG + Intergenic
927253354 2:21018177-21018199 TGGCAGAAGAGATATGAGAAGGG - Intronic
927279646 2:21293010-21293032 GAGGTGAAGAAAAATGAAAGTGG - Intergenic
927325710 2:21802699-21802721 CAGGGGAACAAAAATAAGAAAGG - Intergenic
927648586 2:24897234-24897256 GAGGAGGAGAAAAAGGAGAAGGG - Intronic
928017652 2:27673368-27673390 AAGGAAAGGAAAAAAGAGAAGGG - Intronic
928126779 2:28621954-28621976 TAAGAGAAGTGAAGTGAGAAAGG - Intronic
928268281 2:29831105-29831127 GAGGAGAAGAAGAAGAAGAAGGG + Intronic
928275668 2:29898049-29898071 TAGAAGAAGAGAAAAGGGAAAGG + Intronic
928320566 2:30279978-30280000 GAGGAGAAGAAGAAGAAGAATGG - Intronic
928736168 2:34292101-34292123 CAGAAGAAAAGAAATGAGAATGG + Intergenic
928938717 2:36706318-36706340 TAGAACAATAAATATGAGAAGGG + Intronic
928958678 2:36898948-36898970 GAAGAGAAGAAAATGGAGAAGGG + Intronic
928985983 2:37182118-37182140 GAGGGGAAGCAAAATAAGAAAGG - Intronic
929817104 2:45241628-45241650 GAGGACAAGAACAATGATAAAGG + Intergenic
929875140 2:45790674-45790696 AAGGAGAAGAAAAACGTGAAGGG - Intronic
930131019 2:47850887-47850909 TAGGGGAACAAATATGAGAATGG - Intronic
930207517 2:48602770-48602792 GAGTAGAAGAAAAAAGAGAATGG + Intronic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930403313 2:50920033-50920055 TAGATGTAGAGAAATGAGAAAGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930648983 2:53945359-53945381 TAGAAGAAGTAAAATTGGAAAGG - Intronic
930849590 2:55944585-55944607 TAGAAGAGGAAAAAGTAGAATGG - Intergenic
930898130 2:56469922-56469944 TAGAAGGAGAAAAAAGAGAAAGG + Intergenic
931265163 2:60653979-60654001 GAGGAGAAGAAGATGGAGAAAGG + Intergenic
931337774 2:61365775-61365797 TGGGAGGTGGAAAATGAGAAAGG + Intronic
931455431 2:62406439-62406461 TAAGAGGAGAAAAACGAGATTGG + Intergenic
931961712 2:67490011-67490033 TAGGAGGAGGTAAAAGAGAAAGG + Intergenic
932097509 2:68864680-68864702 TAAGAGGAGGAAAATCAGAAGGG - Intergenic
932098853 2:68878010-68878032 AAGAAGAAGAAAAAAGAAAAGGG - Intergenic
932099416 2:68883907-68883929 AAGGAGAAAGAAAAGGAGAAAGG - Intergenic
932099779 2:68888136-68888158 TACAAGAAGAAAAATTAGCAGGG + Intergenic
932592049 2:73073532-73073554 TAGGAGAAGAAACATCAACAAGG + Exonic
932985025 2:76715733-76715755 CAGAATAAGAAACATGAGAACGG + Intergenic
933003331 2:76955460-76955482 TATGAAAAATAAAATGAGAAAGG + Intronic
933096739 2:78192904-78192926 AAGGAGAAGAAAAAGAAAAAGGG + Intergenic
933121953 2:78549202-78549224 TAGGATCAGAGAGATGAGAAAGG + Intergenic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933171671 2:79132312-79132334 GAGGGGAAGCAAAATGGGAAGGG - Intergenic
933199619 2:79434322-79434344 GAGAAGAAGAAAAATAAGAGAGG + Intronic
933214882 2:79618609-79618631 TTGGAGAAGAAAAACAAGAATGG - Intronic
933270959 2:80232440-80232462 TGGGAGATGAAGAAGGAGAAGGG - Intronic
933311999 2:80672389-80672411 TAGGACAAGACAAATTAGAGAGG + Intergenic
933448004 2:82406785-82406807 TAGGAAAAGAAGAAACAGAATGG + Intergenic
933501067 2:83112030-83112052 TAGAAAAAGAAAAATGATACTGG + Intergenic
933505350 2:83170328-83170350 TAGGAAAAAAAGAAGGAGAAGGG - Intergenic
933529762 2:83492467-83492489 TAGAACAAGAAAAATTAGCATGG + Intergenic
933597254 2:84294176-84294198 TAGGTGAAGAAACATGGAAATGG + Intergenic
933967864 2:87444706-87444728 TATGTGGAGAAAGATGAGAAGGG - Intergenic
934189302 2:89771570-89771592 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
934248941 2:90329965-90329987 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
934260638 2:91473511-91473533 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
934303955 2:91805457-91805479 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
934329299 2:92047293-92047315 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
934467518 2:94277214-94277236 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
934724841 2:96609343-96609365 AAAGAAAAGAAAAATGAGAGTGG - Intronic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
935035188 2:99364278-99364300 TGGAACAAGAAAAAAGAGAAAGG + Exonic
935198387 2:100834671-100834693 AAAGAAAAGAAAAATGATAAAGG - Intronic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935646350 2:105338231-105338253 TAATAGGAGAAAAGTGAGAAAGG + Intronic
936004430 2:108870405-108870427 CAGAAGGAGAAAAAAGAGAAAGG + Intronic
936042783 2:109162355-109162377 TAAGAGGGGAAAAATGAGAGAGG - Intronic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936325934 2:111505793-111505815 TATGTGGAGAAAGATGAGAATGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936581713 2:113705907-113705929 TGGGAGAAGAAAAAGGGAAAGGG + Intronic
936654480 2:114468961-114468983 AAGGAAAAGACAAATGAAAATGG + Intronic
936763812 2:115819606-115819628 AAGTAGAAGAAAAATAATAATGG - Intronic
936998255 2:118437616-118437638 TAGGGGAAGACAGTTGAGAATGG - Intergenic
937070773 2:119061360-119061382 AAGGAAAAGAAAGATGAAAAGGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937492172 2:122381474-122381496 TTTGAGAAGAAAGATTAGAATGG + Intergenic
937503582 2:122511105-122511127 ACGTACAAGAAAAATGAGAAAGG - Intergenic
937545535 2:123013721-123013743 TAGAAGAAAAAAAATCACAAGGG + Intergenic
937768795 2:125694848-125694870 GAAGAGAAGAAAGATGAGAGAGG + Intergenic
938251544 2:129819658-129819680 AAAAAGAATAAAAATGAGAATGG + Intergenic
938264360 2:129915798-129915820 CAGAACAAGAAAACTGAGAAGGG + Intergenic
938919387 2:135980835-135980857 TTGGAGAAGAAAAAGGGTAATGG + Intronic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939115841 2:138059485-138059507 TAGGAGAAAAAAATGGAGATAGG - Intergenic
939161363 2:138593748-138593770 TAGTAGAACAAAATTGAGACCGG - Intergenic
939164787 2:138628763-138628785 TTTGGGAAGACAAATGAGAAGGG - Intergenic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
939462959 2:142520690-142520712 TAGAAGGAAAAAGATGAGAAGGG + Intergenic
939535073 2:143417414-143417436 TGGGGGAAGTAAAATGAGAGGGG + Intronic
939691321 2:145265208-145265230 TAGTAGGAGAAAAATGAGAGGGG - Intergenic
939855389 2:147352832-147352854 TGGGAGAAGATAAATCAGAAGGG - Intergenic
939900182 2:147842186-147842208 TTTGGGAAGGAAAATGAGAAAGG - Intergenic
940373415 2:152926330-152926352 TAGGGCTAGAAAAATGAAAAAGG - Intergenic
940761234 2:157741678-157741700 GAGGAGCAGAATAATGAGAAAGG + Intronic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
940966247 2:159840018-159840040 AAGAAAAAGAAAAAAGAGAAAGG + Intronic
940979789 2:159988846-159988868 AAGGAGAAGAAAGAAGACAAAGG + Intronic
941266919 2:163373773-163373795 TAGAAGAGGAAGAATCAGAAAGG + Intergenic
941469885 2:165871358-165871380 TAGTTGAACAAAAATTAGAAGGG + Intronic
941609428 2:167642693-167642715 TATGAGAAGAAAAATAAGGCAGG - Intergenic
942300560 2:174557243-174557265 TGGGGGAAGACAAAGGAGAAGGG + Intergenic
942382342 2:175404874-175404896 AAAGAGAAGAAAAAAGACAATGG - Intergenic
942440237 2:176027188-176027210 TATTACAAGAAAAATGAAAATGG + Intergenic
942453241 2:176121651-176121673 TAGGGGGAAAAAAATCAGAAGGG + Intergenic
942464237 2:176190236-176190258 TGGGAGAACAAAAATGAATAGGG + Exonic
942528871 2:176886825-176886847 AAAGAGAAGAAACATGACAATGG - Intergenic
942673956 2:178406917-178406939 AAGGAAAAGAAAATTGATAAAGG + Intergenic
942744846 2:179220378-179220400 TAGGAGCAGCAAAAGGAAAAAGG + Intronic
942843691 2:180397087-180397109 TAGGGCAAGAAAGATGGGAATGG + Intergenic
943404879 2:187469240-187469262 TATGAGAAGAAATTTGAGACAGG + Intronic
943582386 2:189700096-189700118 AAAGAGAAGAAAAATGATATAGG - Intronic
943694456 2:190909640-190909662 TAGGAGAAGAAATAGGAGTTTGG + Intronic
943733184 2:191325039-191325061 GAAGAGAAGGAAAAGGAGAAAGG - Intronic
944085252 2:195838458-195838480 CAGGAGAAAAAAAAACAGAAAGG + Intronic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944781787 2:203026022-203026044 TAGAAGCAGAAGAATTAGAAGGG - Intronic
944996581 2:205301589-205301611 AAGGAGAAGAAAAAGGAAAAGGG + Exonic
945101742 2:206268677-206268699 TAGAGAAAGAAAAAAGAGAAAGG + Intergenic
945155162 2:206830426-206830448 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
945615820 2:212064769-212064791 TAGAGAAAGAAAAAGGAGAAAGG + Intronic
945744432 2:213703091-213703113 CAGGAGAGGGAAAAAGAGAATGG - Intronic
945966056 2:216188066-216188088 TAGGGGAAGAAAAAAGAGTGAGG - Intronic
946252872 2:218424122-218424144 GAGGAGAAGAAAACTGTGAGGGG - Intronic
946278616 2:218649631-218649653 TAAGAGAAGCAAAATCACAAGGG + Intronic
946346302 2:219113644-219113666 GAGGGGGAGAAAAATGAGAGTGG - Intronic
946382091 2:219355648-219355670 GAGGAGGAGAAAAATTAGGATGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946658579 2:221975666-221975688 TTGGAGAGGAAAATTGAGAATGG - Intergenic
947077671 2:226363768-226363790 AAGGAGAAGAAAAGAAAGAAGGG + Intergenic
947106468 2:226673095-226673117 AGGGAGAAAAAAAATGAAAAGGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947288218 2:228542210-228542232 TCTGAGAACAAAAATGGGAAAGG - Intergenic
947935664 2:234001439-234001461 TAGGGGAACAAAAGTTAGAAAGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948081626 2:235210174-235210196 TGGGAGAAGAGAAATTAGAGAGG + Intergenic
948086048 2:235249273-235249295 TAGGAGAAGAATAAAGCCAAGGG + Intergenic
948244466 2:236467367-236467389 TAGGAGAAAAAAAATCACTATGG + Intronic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948554563 2:238799005-238799027 AAGGAAAAGAAAGATAAGAAAGG + Intergenic
948580197 2:238981894-238981916 TAGGATTAGGAAAAGGAGAAAGG - Intergenic
1168854769 20:1000991-1001013 AAGGGGAAGGAAAATGAGAGAGG - Intronic
1168981019 20:2003617-2003639 TAGGAGAAGAAAAAGCAGTGAGG - Intergenic
1169099948 20:2938687-2938709 CAGCAAAAGAAAAATGATAAAGG - Intronic
1169260767 20:4136425-4136447 AAGGAGGAGAGAAAAGAGAAGGG - Intronic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169582219 20:7036440-7036462 TAGGAGAAGAGGCATCAGAATGG - Intergenic
1169824933 20:9757111-9757133 TAGGAGAGGAGAAATGAGACAGG - Intronic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170045019 20:12075757-12075779 TTGAAGAAGACAGATGAGAAGGG - Intergenic
1170193722 20:13669417-13669439 CAGAAGAAGAAAAAAGAAAAAGG - Intergenic
1170241055 20:14166759-14166781 TGGGAGAGGAACAATGAGAAGGG - Intronic
1170333378 20:15240574-15240596 AAGAAGAAGAAAAAGGAAAATGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172297930 20:33826664-33826686 TGGGAGAACAAACAAGAGAAAGG - Intronic
1172729953 20:37078722-37078744 TAGAGGAAGAAAAAGTAGAATGG + Intronic
1173052237 20:39574651-39574673 TAGGAGAAGGCTATTGAGAAGGG - Intergenic
1173590194 20:44219157-44219179 TAGGAGGAGGGAAAGGAGAAAGG - Intergenic
1173677068 20:44845113-44845135 TAAGAGAAGAGACAAGAGAATGG - Intergenic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1174442537 20:50567455-50567477 TAGGTGAAAATAGATGAGAATGG + Intronic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174845011 20:53935724-53935746 TAAGAGGAGAAAAAAGGGAAGGG - Intergenic
1174906732 20:54559921-54559943 TGGGAGAATAAAAATAATAATGG - Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1174959976 20:55144913-55144935 TAGTTGAAGATCAATGAGAAAGG - Intergenic
1174983160 20:55420178-55420200 TTAGAGGAGAAAAATGAGCAAGG - Intergenic
1175207843 20:57325533-57325555 TAGGGAAAGAAAAAGGACAAGGG + Intergenic
1175356753 20:58374926-58374948 GGGGAGCAGAAAAATGAAAATGG + Intergenic
1175411275 20:58771093-58771115 CAAGAGAAAGAAAATGAGAAGGG + Intergenic
1175620535 20:60443186-60443208 AGGCAGAAGAAAAATGACAATGG - Intergenic
1176586353 21:8591109-8591131 AACGAAAAGAAAAAAGAGAAAGG - Intergenic
1176743056 21:10623828-10623850 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177214328 21:18108725-18108747 TAGAAAAAGAATTATGAGAATGG + Intronic
1177243905 21:18497665-18497687 GGGGAGAAGATACATGAGAAAGG + Intergenic
1177357622 21:20030315-20030337 TAGAAGAAGAAGATGGAGAAAGG + Intergenic
1177423836 21:20897068-20897090 CAGGAGGAGGAAAATCAGAACGG + Intergenic
1177531043 21:22358433-22358455 TAGTAGAATAAATATGAGAGTGG + Intergenic
1177627056 21:23675244-23675266 TAGGCAAAGAAAACTTAGAAGGG - Intergenic
1177640910 21:23844092-23844114 TATGTGGAGGAAAATGAGAATGG + Intergenic
1178021809 21:28416873-28416895 TAGCAGGAGAAAAAATAGAAGGG - Intergenic
1178460699 21:32799593-32799615 CAAGAGAAGAAAATTGTGAAAGG - Intronic
1178684557 21:34701044-34701066 TAGGAGAAAAAAAATCAGTGAGG + Intronic
1179186194 21:39086945-39086967 AAGGAGAAATGAAATGAGAAGGG + Intergenic
1179815210 21:43901337-43901359 AAAGAGAAGAGAAAAGAGAAGGG + Intronic
1180021735 21:45132879-45132901 TAGACGAAGAAGAAAGAGAAGGG + Intronic
1180269159 22:10568012-10568034 AACGAAAAGAAAAAAGAGAAAGG - Intergenic
1180534288 22:16383171-16383193 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181722648 22:24787590-24787612 GAGGAGAAGAGAAGAGAGAAGGG - Intergenic
1181911732 22:26243814-26243836 CCAGAGAAGAAAAATGAGCAGGG + Intronic
1181911739 22:26243857-26243879 CAAGAGAAGAAAGATGAGCAGGG + Intronic
1181911783 22:26244185-26244207 AAAGAGTAGAAAAATGAGCAGGG + Intronic
1182274237 22:29175463-29175485 TATCAGAAGAAGAAAGAGAAAGG - Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182736986 22:32537812-32537834 TGGGAGAAGAAAACTCAGAGAGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182902087 22:33906994-33907016 AAGCAGAAGAAAAAGGAAAATGG + Intronic
1182966525 22:34526650-34526672 TAGGGGAACAAAAAAGAGAGAGG - Intergenic
1183141466 22:35945018-35945040 AAGGGGAAGAATAATGAAAATGG + Intronic
1183772735 22:39940532-39940554 TAGGAACAGGAAACTGAGAAAGG - Intronic
1183878847 22:40808868-40808890 TGAGAGAATAAGAATGAGAAAGG - Intronic
1184673302 22:46027156-46027178 TAATAAAAGAAAAATAAGAAGGG + Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
1203257324 22_KI270733v1_random:148356-148378 AAGAAGAAGAAAAAAAAGAACGG - Intergenic
1203289578 22_KI270735v1_random:21629-21651 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1203315355 22_KI270737v1_random:2625-2647 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
949511051 3:4767447-4767469 AAAGAGAAGAAAAAGAAGAATGG + Intronic
949705324 3:6809900-6809922 TAGGATGAGTAAACTGAGAATGG + Intronic
949867518 3:8558679-8558701 TAGGGGAAGTAACCTGAGAATGG + Intronic
951145451 3:19221043-19221065 TGGCAGAAGGAAAATCAGAATGG - Intronic
951162839 3:19446785-19446807 AGGGGGAAGAAAAAGGAGAAAGG + Intronic
951305875 3:21061395-21061417 TAGGAGAAGGAAAAAGAACATGG - Intergenic
951594871 3:24307423-24307445 TAGGTGGAAAAAAATAAGAAGGG - Intronic
951618554 3:24575667-24575689 CAGGAAAAGAAAAAGGAGATTGG + Intergenic
951916299 3:27804394-27804416 AAGGAGAAAAAAAAAAAGAACGG - Intergenic
952004671 3:28829387-28829409 TAGAAGGAGAAAAATGATATGGG + Intergenic
952071821 3:29646701-29646723 GAAGGGAAGAAAAATGAGAAGGG - Intronic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952134726 3:30404591-30404613 TAGCACAAGAAAAATGAGTAAGG + Intergenic
952179199 3:30900295-30900317 TGGAAGAGAAAAAATGAGAAAGG + Intergenic
952274929 3:31867728-31867750 TAAGACAAGAAGAAAGAGAAAGG + Intronic
952405499 3:33001147-33001169 GAGGAGAAGAGAAGAGAGAAAGG - Intronic
952419579 3:33118973-33118995 TGGGAGAAGAAGAGGGAGAAAGG - Intronic
952470349 3:33642912-33642934 GAGGAAGAGAAAAAGGAGAAAGG + Intronic
952697286 3:36281695-36281717 TGGGAGATTAAAAAAGAGAAAGG + Intergenic
952773710 3:37024671-37024693 TAAGAGAAGGAGAAAGAGAAGGG - Intronic
953094588 3:39762379-39762401 TGGGAGGAGAAAAAGGATAAAGG + Intergenic
953163821 3:40446325-40446347 TAGGAGATGAGGAAAGAGAAAGG + Intergenic
953274233 3:41479204-41479226 CAGGGGAGGAAAAAGGAGAAGGG - Intronic
953648266 3:44775195-44775217 TTGAAGAAGAAAACTGAAAAAGG - Intronic
953673472 3:44981892-44981914 AAGAAAAAGAAAAAAGAGAAGGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954772397 3:52983534-52983556 TAGGAGAAAAAAACTGAACAAGG + Intronic
955094209 3:55781522-55781544 TGGGAGAAGAAAAGGGAGCAAGG - Intronic
955306129 3:57834387-57834409 TACAAGATGAGAAATGAGAAAGG + Intronic
955481350 3:59393731-59393753 TTGGGGAAGGAAAATGAAAAAGG - Intergenic
955577486 3:60381743-60381765 TAGGAGAAAAAAAACAAAAAAGG - Intronic
955678299 3:61472643-61472665 GAGAAGGAGAAAGATGAGAATGG + Intergenic
955777835 3:62452592-62452614 CAGGAGAAGAAAAAAGATATGGG + Intronic
955800225 3:62678915-62678937 TATGAGAAGAAAACAGCGAAAGG + Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956203490 3:66731799-66731821 TAGGAGGAGAAACAGCAGAAAGG - Intergenic
956251994 3:67244228-67244250 TTGGAGAAGAAAGATGTGCAAGG + Intergenic
956278627 3:67531320-67531342 AAGGATATGAAAAATGATAATGG - Intronic
956356952 3:68404496-68404518 TAGGACCAAAAAAAAGAGAAAGG + Intronic
956720406 3:72112569-72112591 TTGTAGAAGGAAAATGAGACTGG + Intergenic
956788000 3:72658500-72658522 TAGGAGAAGAGGAAGGTGAATGG - Intergenic
956906084 3:73766797-73766819 TCAGAGGAGAAAAAAGAGAAAGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
956952494 3:74298552-74298574 TATGAGAAGAAATATTAAAATGG + Intronic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
957104572 3:75869894-75869916 TAGAGGAATAAAAATGAAAAGGG - Intergenic
957130101 3:76213462-76213484 TGTGAAAAGAAAAATGAGAATGG + Intronic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
957282329 3:78169779-78169801 AAGGAGGAGAAAAAAGAAAAAGG - Intergenic
957285977 3:78218241-78218263 TAGGAGAAGAAAGCAGGGAAAGG + Intergenic
957320869 3:78628504-78628526 TGGGATAAGAGAAAAGAGAAAGG - Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957452865 3:80402199-80402221 TAGGAAAAGAAAAAAAAAAATGG + Intergenic
957520400 3:81311590-81311612 AAGGAAAAGAAAAAAGAAAAAGG + Intergenic
957591388 3:82204253-82204275 TAGGAAATAAAAAAAGAGAACGG + Intergenic
957648383 3:82965797-82965819 TACAGGAAGAAAAAAGAGAATGG + Intergenic
957773538 3:84725263-84725285 TAAAAAAAGAAAAATGAAAAAGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957958993 3:87226130-87226152 CAGGAGGGGAAAAATGGGAAAGG + Intergenic
958257868 3:91345990-91346012 TAAGAGAACATATATGAGAATGG - Intergenic
958687223 3:97414178-97414200 TAGGAAAATTAAATTGAGAAAGG + Intronic
958721092 3:97844563-97844585 TAAGAGAAGAAAAGGGAGCAAGG - Intronic
958908619 3:99968855-99968877 TAGGGTAAGAAAGTTGAGAAGGG + Intronic
958911724 3:100001666-100001688 TGGGAGAGGAAAGAAGAGAAAGG - Intronic
958988480 3:100812078-100812100 TACGAAAAAAAAAATGAAAATGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959452590 3:106522266-106522288 TTGGATAAGAAAAATAAAAAGGG - Intergenic
959582691 3:107998160-107998182 TTGGAGTAAAAATATGAGAAGGG + Intergenic
959652011 3:108759223-108759245 GAAGAGAAGAAAAATGAGACTGG + Intergenic
959711645 3:109391605-109391627 GAGGAGAAAAAAAATTAGAGAGG + Intergenic
959745573 3:109772743-109772765 TAGAAAAAGAAAAATTAGACTGG + Intergenic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960077282 3:113501733-113501755 TAAGAGAACTAAAATGAAAAAGG + Intronic
960185648 3:114634918-114634940 TAGGAGCAAAGAAATGAGGAGGG + Intronic
960290859 3:115882783-115882805 TAGGAGTCCAAAAATAAGAATGG - Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960529136 3:118743711-118743733 AAGAAAAAGAAAAATTAGAAAGG + Intergenic
961108143 3:124259795-124259817 AAGGAGAAAAATAAAGAGAAGGG + Intronic
961305514 3:125957092-125957114 TGGGAGTTGAACAATGAGAATGG - Intergenic
961397045 3:126601321-126601343 TACCAGAAGAAAAAGGAGAATGG - Intronic
961773381 3:129266643-129266665 CAGAATAATAAAAATGAGAAAGG - Intronic
961973206 3:130991962-130991984 TAGGAGAATAGGAAAGAGAATGG + Intronic
962314660 3:134351558-134351580 GAGGAGAAAAGAGATGAGAAAGG + Intergenic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962449744 3:135503027-135503049 TAGGAATACAAAAATGAGCAAGG - Intergenic
963099079 3:141581308-141581330 TGGAAGAAGAAAAAAGAAAAAGG - Intronic
963200855 3:142584585-142584607 GAGGAGAGAGAAAATGAGAAAGG - Intergenic
963623072 3:147635850-147635872 TAGGACAAAAAAAATCTGAACGG + Intergenic
963797908 3:149649526-149649548 TAGCAGAAAATAAATAAGAAAGG - Intronic
963824760 3:149940553-149940575 AAAGAGAAGAAAAATGATATAGG - Intronic
963895235 3:150678742-150678764 TAAAAGAAGAAAAATGAGACTGG + Intronic
964018643 3:151979264-151979286 TTAGAGAAGAAAAATGAAAAAGG - Intergenic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964205555 3:154171010-154171032 TTGGAGAAGAGAAATGGGAGAGG + Intronic
964233257 3:154495482-154495504 AGGGAGAGGAGAAATGAGAACGG - Intergenic
964361410 3:155901130-155901152 TAGGAAGAGAAGAATGTGAATGG - Intronic
964404723 3:156337447-156337469 AAGAAGAAGGAAAATGAAAAGGG - Intronic
964412705 3:156415688-156415710 TCGGCAAAGAAAATTGAGAAGGG - Intronic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
964539562 3:157764490-157764512 GAGGTGAAGTAAGATGAGAATGG + Intergenic
964683019 3:159363030-159363052 TGGAAGTAGAAAACTGAGAAGGG - Intronic
964727322 3:159827185-159827207 TGAGAGAATGAAAATGAGAAAGG + Intronic
964877952 3:161390711-161390733 TAGGAGAACCAAAAGGAAAAAGG + Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965173292 3:165296440-165296462 TGGGAAAAGAAAAAATAGAAAGG - Intergenic
965259481 3:166462738-166462760 TAAGAGTAAAAATATGAGAATGG - Intergenic
965316161 3:167193376-167193398 AAAAAGAAGAAAAATCAGAATGG - Intergenic
965329444 3:167352244-167352266 TAGATTAAGAAAAATGAGAGAGG + Intronic
965410746 3:168327424-168327446 AAGGAGAAGAAAAACGTGTAGGG - Intergenic
965415633 3:168388885-168388907 TGGGAGAAGAATAATTTGAAAGG + Intergenic
965675258 3:171188061-171188083 TAGCAGAATAGAAAAGAGAAGGG + Intronic
965746833 3:171935127-171935149 TGGGGGAAGATGAATGAGAATGG + Intronic
965933221 3:174072452-174072474 TAAGAGAACAAAAATAAGATTGG + Intronic
965935624 3:174106862-174106884 TAGAAGAAAAAAAAGGAGAAAGG - Intronic
966038283 3:175447420-175447442 TAGGAGATTAAAAATGATCATGG - Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
966587610 3:181644898-181644920 AAAAAAAAGAAAAATGAGAAAGG + Intergenic
966607887 3:181839768-181839790 TAAGTGTAGAAATATGAGAAGGG + Intergenic
966743975 3:183258311-183258333 TGGGAGAAAGAAAAGGAGAAGGG - Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967140998 3:186560152-186560174 TAGGAGTATAAAAATGGAAAAGG - Intronic
967336691 3:188352051-188352073 TAATAGAAGAAAAATGACAAGGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967410412 3:189161251-189161273 TAGCAAAAGAAAAATGAGAGAGG - Intronic
967811425 3:193764349-193764371 GAGGAGAAAAACAATGTGAAGGG - Intergenic
967865250 3:194184755-194184777 TAGGAGGAGGAAGAGGAGAAGGG + Intergenic
967932690 3:194701945-194701967 AAGAAGAAGAAAAAGAAGAAAGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968677890 4:1894933-1894955 TGGGGGAAGAAAAAGGAGGATGG - Intronic
969243186 4:5915405-5915427 TAGGAGATGACAAAGGAGAAAGG - Intronic
969661447 4:8531791-8531813 TAGTAGAACAAAAATGACACGGG - Intergenic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
969832257 4:9807287-9807309 TAGAAGAAATAAAATGAGCAGGG - Intronic
969871349 4:10106996-10107018 TTGGGGAAGAAGAATGAGATTGG + Intronic
970095399 4:12458338-12458360 GAGGGGAAGAAAAAAGAGTAGGG - Intergenic
970122362 4:12770819-12770841 TGGGTGAAGAAAAATGATGAGGG + Intergenic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970338751 4:15082489-15082511 GAGGAGAAGGCAAAGGAGAAAGG + Intergenic
970435961 4:16035890-16035912 TAGAAGGATAAACATGAGAAAGG + Intronic
970645295 4:18113826-18113848 GAGGAGAAGAAGAAGGGGAAGGG + Intergenic
970726707 4:19054672-19054694 AAAGAAAAAAAAAATGAGAAAGG - Intergenic
970938346 4:21601497-21601519 TAGGGGAAGAGAAAGGGGAAAGG - Intronic
970982698 4:22120345-22120367 TAGTAGAAGAATAAATAGAATGG + Intergenic
971017279 4:22501330-22501352 TTGAAGGAGAACAATGAGAAAGG + Intronic
971191049 4:24429544-24429566 TAGGACATGAAAAACAAGAAGGG + Intergenic
971691065 4:29836788-29836810 TATGAGAAGAAAAAGGATAGGGG - Intergenic
971725541 4:30307244-30307266 TAGGAAAAGAAAAGTAAGAAAGG + Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
971818116 4:31516279-31516301 AAGGATAAGAAAAATAAGATAGG + Intergenic
971840668 4:31847950-31847972 TAAGGGAAGAATCATGAGAAAGG + Intergenic
972001102 4:34034723-34034745 TAGGAGATGTAAAAAAAGAATGG - Intergenic
972300980 4:37785390-37785412 TAGGAGAGGAAGAATTAGCAGGG + Intergenic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972559422 4:40213723-40213745 TAGAAGAAGGAAAATTACAATGG - Intronic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973090157 4:46125408-46125430 TGGGAGAAGAAAAACAAGGAGGG - Intergenic
973150539 4:46881814-46881836 TAGCAGAAGACAACTGTGAAAGG - Intronic
973305152 4:48639254-48639276 AAGGAGAAGAAAAATGTCAGAGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973632190 4:52829973-52829995 TGGGAAGAGAAAAAGGAGAAAGG - Intergenic
973657125 4:53059607-53059629 CAGGAAAAAAAAAAAGAGAAAGG - Intronic
973686082 4:53371221-53371243 TAGTTGAAGGAAAATGAAAAAGG + Intergenic
973694599 4:53477779-53477801 CAGGAGGAGAAAAAAGAGAAAGG + Intronic
973779171 4:54272022-54272044 GGTGAGAAGAAAAATGGGAAGGG - Intronic
973894489 4:55397645-55397667 GAGGAAAGGAAAAAGGAGAAAGG - Intronic
974081048 4:57212929-57212951 TAGGGAAAGAAAAAAAAGAAGGG + Intergenic
974455629 4:62126205-62126227 TAGCAGAAGAAAACTGTCAAGGG - Intergenic
974648360 4:64723199-64723221 TAGAAGAAAAAAGCTGAGAAAGG + Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
974809504 4:66927827-66927849 AAGGAGAAGAAAAAAGAAAAGGG + Intergenic
974812583 4:66964257-66964279 TATAAAGAGAAAAATGAGAAAGG + Intergenic
974997026 4:69174225-69174247 GAGGGGAAAAAAGATGAGAATGG - Intronic
975053364 4:69894669-69894691 TAAGAGATGAAAAATGAATATGG + Intergenic
975172998 4:71254499-71254521 TGAAAAAAGAAAAATGAGAATGG + Intronic
975337950 4:73203228-73203250 TAGGGGCAGAAAACTGGGAAAGG - Intronic
975391308 4:73821002-73821024 TAGAAGATGAAAAATGAGTTGGG + Intergenic
975411912 4:74062766-74062788 CAGAGGAAGAAAAATGGGAAAGG - Intergenic
975903018 4:79175629-79175651 TATCAGGAGAAAAATGATAATGG - Intergenic
975915288 4:79317804-79317826 GAGAAGAAAACAAATGAGAAAGG + Intronic
976041902 4:80897045-80897067 TATCAGCAGAAAAATGAAAAAGG + Intronic
976119765 4:81767104-81767126 TAGGAAAAGTAAAGTGAGAAAGG - Intronic
976267607 4:83199193-83199215 GAAGAGAGGAAAAATGTGAATGG + Intergenic
976604929 4:86973731-86973753 AAGGAAAAGAGAAAAGAGAAAGG - Intronic
976671502 4:87659617-87659639 TAAGAAGAGAAAAATGAGTAAGG + Intronic
976777179 4:88719570-88719592 GAGGAGGAGAAGAAGGAGAAAGG - Intergenic
976920021 4:90428235-90428257 TTGGAGAGGGAAAAAGAGAAAGG - Intronic
977011192 4:91635641-91635663 TGAAAGAAGAGAAATGAGAAAGG + Intergenic
977079361 4:92504279-92504301 TAAGAGAAAAGACATGAGAATGG + Intronic
977281598 4:95046860-95046882 TACAAGAAGAAATATCAGAAAGG - Intronic
977315746 4:95445254-95445276 CAGGAGAAAAAAACTAAGAATGG - Intronic
977320389 4:95507522-95507544 TAGAGGAAGAAAAATCAGAGAGG - Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977427489 4:96886711-96886733 TGGGAGAAGAAAAGAGAGAGAGG + Intergenic
977437746 4:97021373-97021395 TAAAATAAGAAAAAAGAGAAAGG - Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977476724 4:97519829-97519851 GAGATGAAGAAAAAGGAGAAAGG + Intronic
977795317 4:101157573-101157595 TAGTACAAGGAAAATGAGACTGG + Intronic
977998152 4:103521106-103521128 TAAGAAAAGAAAATTTAGAATGG - Intergenic
978014904 4:103731530-103731552 AATGAGAAGGGAAATGAGAAGGG + Intergenic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978129943 4:105183873-105183895 TAGGAGAAGAAAGGAGTGAAAGG - Intronic
978565211 4:110073989-110074011 TAGGAGAAGACAAATGCAATGGG + Intronic
978721874 4:111919714-111919736 TTGATGATGAAAAATGAGAATGG - Intergenic
978766549 4:112411159-112411181 GAGGAGAAGAAATAAGATAAGGG + Intronic
978849730 4:113319532-113319554 TAGAATAATAAAAATAAGAAAGG - Intronic
979020802 4:115494670-115494692 TAGAAGAAAAAACAAGAGAAAGG - Intergenic
979058511 4:116025297-116025319 CAGGAGAGGAGAAATGAGACAGG - Intergenic
979081992 4:116357119-116357141 TAGAAGAAAAAAACTAAGAATGG - Intergenic
979153719 4:117355478-117355500 TAGGAGAAGAAATGTGAAAAAGG + Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
979865469 4:125747661-125747683 TGAGATAAGAAAAATGATAAGGG + Intergenic
979907933 4:126320527-126320549 GGAGAGAAGAAAAATGTGAAGGG + Intergenic
979947302 4:126849075-126849097 TAAGAGAAGTCAAAGGAGAAGGG + Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980158459 4:129133473-129133495 CAGGAGCTGAAAAAGGAGAAAGG - Intergenic
980384097 4:132063320-132063342 TGGGAGAAGAAACAAGAGAAAGG + Intergenic
980560461 4:134466110-134466132 TTTGAGAACAAAAATAAGAATGG + Intergenic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
980741251 4:136952363-136952385 TAGGGGAAGGAAAATCAGAGAGG + Intergenic
980909853 4:138984075-138984097 TAAAAAAAAAAAAATGAGAAGGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981416795 4:144503299-144503321 AAGAAGGAGAAAAATAAGAAGGG + Intergenic
981950707 4:150403549-150403571 AAGGAGAAGGGAAAGGAGAAGGG - Intronic
982019043 4:151185360-151185382 CAGGATAGGAAAGATGAGAAGGG - Intronic
982027091 4:151261683-151261705 TAGCAGAAGAAATATGAAAGAGG - Intronic
982176232 4:152707931-152707953 TCGGAGAAGGAAATAGAGAAAGG + Intronic
982201740 4:152968197-152968219 TTGGAGAAAAAAAATATGAATGG - Intronic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982364369 4:154559185-154559207 GAGGAGAAGAAGAAGGGGAAGGG - Intergenic
982392309 4:154877950-154877972 CATTAGAAGAAAAAAGAGAATGG - Intergenic
982446258 4:155493986-155494008 TATGAGAAGTAAACTGAGACAGG + Intergenic
982632357 4:157846675-157846697 AAGGAGAGGAATAAGGAGAATGG + Intergenic
983262713 4:165474452-165474474 GAGGAGAAAAAAAAGGAAAAAGG + Intronic
983301810 4:165935128-165935150 AAGGAGATGGAAAATCAGAAAGG + Intronic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
984057798 4:174950503-174950525 TAGGAGAATGGAAAAGAGAAAGG - Intronic
984191034 4:176605865-176605887 GAAGAAAAGAAAAAGGAGAAAGG + Intergenic
984629408 4:182045012-182045034 TTGTAGAACAAAAATCAGAATGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
985189384 4:187355288-187355310 GATGAGAATAAGAATGAGAACGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986241950 5:5968260-5968282 TAGGCAAAAGAAAATGAGAAGGG + Intergenic
986278658 5:6304545-6304567 GAGGAAAAGAAAAAGGAGACGGG + Intergenic
986436656 5:7740120-7740142 TAGCCGAAATAAAATGAGAAAGG + Intronic
986514833 5:8550438-8550460 CAGGATATGAAAAATGAGATGGG - Intergenic
986733877 5:10654025-10654047 TGGGAGAAGAAAACAGACAAAGG - Intergenic
986777437 5:11030335-11030357 CAGGAGAAAAAAAGTGGGAAAGG - Intronic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
987028961 5:13958450-13958472 TATCAGAAGAAAAATAGGAAGGG - Intergenic
987042771 5:14078312-14078334 AAAGAGAAGAAAAAAGAGCAAGG - Intergenic
987495931 5:18644722-18644744 TAGCAGAAGAAAATTGTCAAGGG + Intergenic
987865362 5:23528951-23528973 AAACAGAAGAAAAAGGAGAAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988169896 5:27639871-27639893 TAGGAGAAGAAGAAAGAAAAGGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
989293461 5:39796109-39796131 TAGGAGGAAAACAAAGAGAAAGG + Intergenic
989542440 5:42632773-42632795 TAGGATAAGAAGAATGTTAAGGG + Intronic
989814844 5:45723260-45723282 GAGGAGAAAGAAAATGAAAAGGG + Intergenic
990078108 5:51876297-51876319 TCTAAGAAGAAAAAAGAGAATGG - Intergenic
990472778 5:56131835-56131857 GAAGAGAAGAAAAATGATATAGG + Intronic
990488514 5:56281700-56281722 TGGCAAGAGAAAAATGAGAAAGG + Intergenic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990715376 5:58630659-58630681 TGGGAGAAAGACAATGAGAAAGG + Intronic
990818170 5:59808351-59808373 TAGGAGAAGAAAATAGATATTGG - Intronic
990842569 5:60100145-60100167 TAGGAGCAGGACAGTGAGAAAGG + Intronic
990942643 5:61218769-61218791 TATCAGAAGAAAAAAGAGATGGG - Intergenic
991007955 5:61849503-61849525 CAGGCTAAGAAAAAAGAGAAAGG + Intergenic
991288109 5:65003389-65003411 TAGGAGAAGAAGAAAGGGAAGGG - Intronic
991311630 5:65249428-65249450 TAAGGGAAGAATCATGAGAAAGG + Intronic
991611352 5:68452825-68452847 TAGGTTAAGAGAAAAGAGAAAGG + Intergenic
991619567 5:68531577-68531599 CAGCAAGAGAAAAATGAGAAGGG - Intergenic
991638791 5:68733117-68733139 TAGGGGAAGCCAAATCAGAATGG + Intergenic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
991698833 5:69298522-69298544 CAGGAGTAGGAAAATGAAAAGGG - Intronic
991957077 5:72005685-72005707 TGGGAGAAGAACAATAAGTATGG - Intergenic
992437813 5:76772307-76772329 GAGGAGAGGAAAACAGAGAAAGG + Intergenic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992813985 5:80418221-80418243 GAGGAGAAGAGAAAGGAGAGAGG - Intronic
993003579 5:82407028-82407050 AAGTAGAAGAAACATCAGAAAGG + Intergenic
993031329 5:82709361-82709383 TGGGTGAAGAAAATTAAGAATGG - Intergenic
994417092 5:99485762-99485784 TAGGAATAGAAAAATGTGCATGG + Intergenic
994442848 5:99832020-99832042 TAGGAAAAGTAAAATAAGACAGG + Intergenic
994462883 5:100089406-100089428 TAGGAATAGAAAAATGTGCATGG - Intergenic
994587899 5:101734268-101734290 CTGAAGAAGAAAAATAAGAAAGG - Intergenic
994653749 5:102562849-102562871 TCAGAGAAAAAAAAAGAGAATGG + Intergenic
994782474 5:104109591-104109613 TAGGAAAAAAAAAATTAAAAGGG + Intergenic
994814004 5:104560306-104560328 TAAGAACAGAAGAATGAGAATGG - Intergenic
994930231 5:106173244-106173266 TTGGAGAACAAACATGAGAGGGG - Intergenic
994943396 5:106354693-106354715 TGGGAGAAGAAAAATAATATAGG - Intergenic
994982186 5:106889612-106889634 TATGAGAGGAGACATGAGAAGGG - Intergenic
995088963 5:108149827-108149849 TAGGAGCAGAAAAATAATCAAGG - Intronic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995696605 5:114884976-114884998 TGGGAAAAGCAATATGAGAAAGG - Intergenic
995891523 5:116958129-116958151 TTGGGGAAAAAAAAAGAGAAAGG + Intergenic
995962574 5:117860845-117860867 TAGGAGTAGGAGAATTAGAATGG + Intergenic
995968143 5:117934687-117934709 TTCCAGAAGAAAAATGAGAGAGG + Intergenic
996282793 5:121751675-121751697 TTGCAGAAGAAAAAGGAGAGAGG + Intergenic
996538129 5:124600343-124600365 TTTGAGAATAAAAATGTGAAGGG + Intergenic
996549914 5:124719544-124719566 TAGGAGAGGAAAAAGAAGCATGG + Intronic
996570124 5:124924704-124924726 TAGAATAAAAGAAATGAGAAAGG + Intergenic
996816644 5:127581823-127581845 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
996953481 5:129156090-129156112 TAAGGGAAGAAACATGGGAAAGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997248553 5:132371410-132371432 AAGGGGATGAGAAATGAGAAAGG - Intronic
997339171 5:133129240-133129262 TAGGACATGAAAAAGGAGAATGG - Intergenic
997789558 5:136745178-136745200 TAGAAGAAAAAAAATAATAAAGG + Intergenic
997824089 5:137090996-137091018 TAGCACAAGAGAAATGAAAATGG + Intronic
997944376 5:138186193-138186215 GAAGAGAAGTAAAATTAGAAAGG - Intronic
998630897 5:143897575-143897597 TATGGGAAGAAAAATCAGAGGGG - Intergenic
998650668 5:144118120-144118142 TTGGAGGAGAAAACTGAGATGGG - Intergenic
998704355 5:144741311-144741333 TAGGAGAAGAAAAGGAAGGATGG - Intergenic
998811527 5:145971370-145971392 TAGTTGAGGAAAAAAGAGAAGGG + Intronic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999556385 5:152747032-152747054 TAAAAGAAAAAAAAAGAGAAAGG + Intergenic
999587563 5:153107985-153108007 GAAGAGAATATAAATGAGAAAGG - Intergenic
1000039467 5:157474347-157474369 TTGGAGAAGAACCATTAGAAAGG + Exonic
1000771631 5:165362092-165362114 TAGGACTTGAAAGATGAGAATGG - Intergenic
1000891063 5:166803192-166803214 CAGAAGAAGAAAAATACGAAAGG + Intergenic
1001050351 5:168408994-168409016 TGGGGAAAGAAAAATGAAAATGG - Intronic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1001155951 5:169272636-169272658 TGTGAGAAGAGAAACGAGAAGGG + Intronic
1001279163 5:170373781-170373803 TAAGAGAATGAAAATGAAAAAGG + Intronic
1001418995 5:171572655-171572677 CAGGAGGGGAAAAATGAGACTGG - Intergenic
1001823635 5:174728588-174728610 TATGGGAAGGAAAATGAAAAAGG - Intronic
1001869845 5:175142463-175142485 TGGGAGAAGGAAAATGACATAGG + Intergenic
1002337623 5:178491143-178491165 TAGGAGGAGAAGAGAGAGAAAGG + Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003412137 6:5875011-5875033 TAGAACAAGAGGAATGAGAATGG + Intergenic
1003461748 6:6335065-6335087 TCTGAAAAAAAAAATGAGAAAGG - Intergenic
1003584906 6:7379714-7379736 TAGTAAAAGTAAAATGGGAATGG - Intronic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1004114262 6:12750424-12750446 AAGGAGAGAAGAAATGAGAAGGG + Intronic
1004182439 6:13392753-13392775 GAGAAGAAGAGAAATAAGAAGGG + Intronic
1004390107 6:15202843-15202865 GAAGAAAAGAGAAATGAGAAGGG + Intergenic
1004528392 6:16430332-16430354 TAGGAAAAAAAAAAAAAGAAAGG + Intronic
1004618788 6:17315248-17315270 TAGGCTAAGAAAGATGAGAACGG + Intergenic
1004842966 6:19607892-19607914 TAAAAGAAGAAGAAAGAGAAAGG + Intergenic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1005194981 6:23271834-23271856 TAGGAGAAAAAAAAAGTGAGTGG - Intergenic
1005509224 6:26497398-26497420 TAAGAGAAGTGAAATGAGGAAGG + Intergenic
1005533478 6:26731919-26731941 TAGGTGAAGAAACATGTCAAGGG + Intergenic
1005537316 6:26769733-26769755 TAGGTGAAGAAACATGTCAAGGG - Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1006583569 6:35090628-35090650 GAGGAGAAGAAAAGAAAGAAAGG - Exonic
1006609444 6:35285040-35285062 AGGAAGAAGAGAAATGAGAAAGG - Intronic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1007662913 6:43497336-43497358 TAGGAGAAGAAATCTGAAAAGGG - Intronic
1008008967 6:46443530-46443552 AAGGAGAAGAAAAGGGAGATGGG - Intronic
1008079656 6:47180652-47180674 TTGGAGAAGAGTTATGAGAATGG - Intergenic
1008147299 6:47907439-47907461 AAGAAGAAGAAAACTGTGAAAGG + Intronic
1008153011 6:47978109-47978131 GAGAAGAAAAATAATGAGAAGGG - Intronic
1008225014 6:48904446-48904468 GAGGAGAAGAAGAAGTAGAAGGG - Intergenic
1008457465 6:51727556-51727578 TAAGGGAAGAATCATGAGAAGGG - Intronic
1008558456 6:52698808-52698830 TATGAGAAAAAAAATAACAAAGG - Intergenic
1008867920 6:56237117-56237139 CAGGAAAAGAAAAATTCGAAAGG + Intronic
1009029828 6:58043340-58043362 TAAGAGAAGGAAAAAGAGAAAGG + Intergenic
1009185907 6:60574117-60574139 TAAGAGAACATATATGAGAATGG + Intergenic
1009205356 6:60794578-60794600 TAAGAGAAGGAAAAAGAGAAAGG + Intergenic
1009694207 6:67077789-67077811 TAGAAAATGAAAAATGAGATTGG + Intergenic
1009882201 6:69582782-69582804 TAGGGGAAGAAGAATCGGAAGGG + Intergenic
1010091883 6:71992488-71992510 GAGGAGAAGAAGAAAAAGAAGGG - Intronic
1010220594 6:73445441-73445463 GAGGTCAAGAAACATGAGAATGG + Intronic
1010478333 6:76317734-76317756 AAGGAGAAAAGAAAGGAGAAAGG - Intergenic
1010650541 6:78449563-78449585 GAGGAGAAGAAATGTCAGAAGGG - Intergenic
1010786642 6:80009922-80009944 TAGCACAAGAAAAGAGAGAAAGG - Intronic
1010849379 6:80752899-80752921 TAGGAAATACAAAATGAGAAGGG - Intergenic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1011293943 6:85807273-85807295 AAGAAGAAGAAAAAAGAAAAAGG - Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012680768 6:102176062-102176084 AAGGAAAACAAAAAGGAGAAAGG - Intergenic
1012976252 6:105784098-105784120 CAGGAGAGCAAAAATAAGAAAGG - Intergenic
1013441700 6:110178752-110178774 GGGGAAAAGAAAAATGGGAAAGG + Intronic
1013480975 6:110552393-110552415 CAGGAGAACAAAGATAAGAATGG - Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013894880 6:115075050-115075072 AAGAAGAAGAAAAAAGGGAAGGG + Intergenic
1013996680 6:116317002-116317024 TGTGAGAAAAAAAATGTGAAGGG + Intronic
1014348435 6:120307251-120307273 TAGGCAAAGATAAGTGAGAAAGG + Intergenic
1014543984 6:122710934-122710956 TGGGAAAAAAAGAATGAGAAGGG + Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014623154 6:123694335-123694357 TAGAAGAAAAAAAATCAGCAAGG + Intergenic
1014629832 6:123774590-123774612 GAGGAGTAGACAAATGAGAGTGG - Intergenic
1014776088 6:125511449-125511471 GAGGAGAAGAGAAAGGAGAGGGG - Intergenic
1014819455 6:125971173-125971195 CAAGAGAAGAAAGATGATAAAGG + Intronic
1014886124 6:126783814-126783836 TAGGGGAAGATAAAGGAAAAGGG - Intergenic
1015014930 6:128400940-128400962 GAGGGAAAGAAAAATGAGCAAGG + Intronic
1015034608 6:128638418-128638440 TAGGAAATAAAAAATAAGAATGG + Intergenic
1015169220 6:130232415-130232437 AAGGAGCAGAAAAATGAAACAGG - Intronic
1015278941 6:131411684-131411706 AAGAAGGAGAAAAATGAGACTGG + Intergenic
1015434971 6:133174743-133174765 AAGAAGAAGACAAAGGAGAAGGG - Intergenic
1015446604 6:133312829-133312851 ATGGAAAAAAAAAATGAGAAGGG - Intronic
1015654385 6:135500096-135500118 AAGGCTAAGAAAAATCAGAATGG + Intergenic
1015711305 6:136143614-136143636 TAGGTGAAGAAAAATAGGTAAGG + Intronic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1016576808 6:145578173-145578195 TAGAAGAAGAGAAATAATAAAGG + Intronic
1017081746 6:150676095-150676117 AAGGAGGAGAAAATTGAAAAGGG + Intronic
1017098232 6:150824204-150824226 TAGGAGAGGGAGAATAAGAATGG + Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017659519 6:156660032-156660054 CAGAAGGAGAAAAAAGAGAAAGG + Intergenic
1017713120 6:157187398-157187420 CAGTGGAAGATAAATGAGAAAGG + Intronic
1018411997 6:163558956-163558978 TAAGAGAATAAAAATAAGAGTGG - Intronic
1018570274 6:165202781-165202803 TTGGAGAAAAAAAAAGAGATAGG + Intergenic
1018630408 6:165817161-165817183 TGGGAGAAGAAAGATGTGACAGG - Intronic
1018756668 6:166855503-166855525 AAGAAGAAGAAGAATAAGAAGGG + Intronic
1019215670 6:170441697-170441719 TGGGAGTGCAAAAATGAGAAAGG + Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019535282 7:1526141-1526163 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535306 7:1526228-1526250 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1020112751 7:5456680-5456702 TAGGAGCAGAGAACAGAGAAGGG + Intronic
1020577823 7:9956620-9956642 TAGGAGAGGAAAAAGGTGGATGG + Intergenic
1020682417 7:11253802-11253824 TAGCAGAACAAAAATGATAATGG + Intergenic
1021052102 7:15999543-15999565 GAAAAGAAGAAAAATGAGAGGGG + Intergenic
1021191757 7:17628507-17628529 CAGGAGAAGCAAATTGAAAATGG + Intergenic
1021280732 7:18714653-18714675 CAAGAGATGAAGAATGAGAAGGG - Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021352641 7:19613839-19613861 TGGGAGGAGAAAAATGATAGAGG + Intergenic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021504818 7:21370126-21370148 TAAAAGAAAAAAAGTGAGAATGG - Intergenic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1021795716 7:24251923-24251945 AAGGAGAAGAAAGAGGAAAAGGG + Intergenic
1022343212 7:29487656-29487678 TAGAAGGAGAAAAAGAAGAAAGG - Intronic
1022551302 7:31242024-31242046 GGGGAGAAGAGAAATGAGATAGG + Intergenic
1022976477 7:35561919-35561941 TAAGATAAGAAAAATGGAAAGGG + Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023036630 7:36136804-36136826 TAGGAATATAAAAATGAAAAAGG - Intergenic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024207793 7:47178647-47178669 ACAGAGAAGAAACATGAGAAAGG + Intergenic
1024225398 7:47322621-47322643 TAGAAAAAGAAAAAAGAAAATGG + Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024929044 7:54650565-54650587 CAGGAGCAGAAAGAGGAGAAAGG - Intergenic
1024960768 7:54972184-54972206 AGGGAGAGGAAAAATGAGATTGG - Intergenic
1025307280 7:57872941-57872963 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1025640276 7:63360818-63360840 TAGAAGAAAAGAAATGAAAAAGG + Intergenic
1025642423 7:63387275-63387297 TAGAAGAAAAGAAATGAAAAAGG - Intergenic
1025837328 7:65106472-65106494 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1025838434 7:65119503-65119525 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1025878843 7:65513593-65513615 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1025884638 7:65576478-65576500 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026205642 7:68255179-68255201 GAGGAGGAGAAAGAGGAGAAAGG - Intergenic
1026205742 7:68255669-68255691 GAGGAGAAAGAAAAGGAGAAAGG - Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026404879 7:70054936-70054958 GAGGAGAAGGAAAAGCAGAAAGG - Intronic
1027302624 7:76856676-76856698 GAGGAGGAAAAAAATGAAAAAGG - Intergenic
1027306430 7:76902598-76902620 TTGCAGAGGAGAAATGAGAATGG + Intergenic
1027391724 7:77710544-77710566 TAAGAGAAGAACAAAGTGAAGGG - Intronic
1027589444 7:80099255-80099277 TAAAAGAGGAAAAATGTGAATGG + Intergenic
1027719776 7:81725578-81725600 AAGCAAAATAAAAATGAGAATGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027978105 7:85184972-85184994 TCGGAGAAGGAAAAGGAGAAGGG + Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1029395876 7:100308348-100308370 AAGAAGAAGAAAAAAAAGAAGGG + Intronic
1029396323 7:100311124-100311146 AAGAAGAAGAAAAAAAAGAAGGG + Intronic
1029396773 7:100313907-100313929 AAGAAGAAGAAAAAAAAGAAGGG + Intronic
1029494150 7:100888189-100888211 TGGGAGAAGAAAACAGAGGATGG + Intronic
1030398524 7:109018962-109018984 AAGGAGAAGGAAAAACAGAAAGG + Intergenic
1030405256 7:109102580-109102602 TTGGAGGAAAAAAATAAGAAAGG - Intergenic
1030463902 7:109875597-109875619 TAGGAAAAAAAAAAAAAGAAGGG - Intergenic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1031279382 7:119777622-119777644 AGGGAGAAGAAAAATGACATAGG + Intergenic
1031371481 7:120972764-120972786 GAGCAAAAGAAAAATGAGAAAGG + Intronic
1031550938 7:123110692-123110714 TAAGAAAAATAAAATGAGAATGG - Intergenic
1031682862 7:124695742-124695764 GAGGAGAGGAGAAAAGAGAAAGG + Intergenic
1031869436 7:127076072-127076094 AAGAAGAAGAAACTTGAGAAAGG + Intronic
1031897496 7:127368185-127368207 TAGGAGAAGAGAAATGAATTTGG + Intronic
1032377811 7:131440958-131440980 TAAGAGAACTAAAATGAGACTGG + Intronic
1033037276 7:137886484-137886506 AAGGAGAGGAAAAACAAGAACGG + Intronic
1033578526 7:142710145-142710167 TAAGGGGAGAATAATGAGAAAGG + Intergenic
1033804342 7:144937470-144937492 AAGGAGAAGGGAAAGGAGAAAGG - Intergenic
1033830758 7:145249615-145249637 TAGAAGAAAAAAAATGAGACTGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033957810 7:146873636-146873658 TATGAGAAGAATAATAAGCATGG + Intronic
1035672554 8:1431493-1431515 AAGAAGAAGAGAAAGGAGAAAGG + Intergenic
1035779887 8:2219768-2219790 TGGGAGAAGAAAAGTGATCAAGG - Intergenic
1035909730 8:3553119-3553141 AAGGAGAAAAAAAAAAAGAAAGG + Intronic
1036409549 8:8486467-8486489 CAGGAGAAAAACAATTAGAATGG - Intergenic
1036558879 8:9884599-9884621 GAGGAAAAAAAAAATGGGAAGGG - Intergenic
1036787631 8:11698529-11698551 GAGGAGGAGAAACAAGAGAAGGG - Intronic
1037298458 8:17426424-17426446 AAGGAGAAGAGAAACAAGAAGGG + Intergenic
1037369754 8:18163116-18163138 AAGGAGAGGAAAAAGTAGAAGGG + Intergenic
1037716977 8:21409026-21409048 CAGCTGAAGAAAACTGAGAATGG + Intergenic
1038120387 8:24607967-24607989 GAGGAGGAGGAAAAGGAGAAGGG + Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039130792 8:34261956-34261978 TAGGAAAAGACAAATGAAAGTGG - Intergenic
1039327092 8:36497450-36497472 TCAGAGAAGAAAAATGAGAAAGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039524675 8:38203621-38203643 TAGGACAAGCAAGATGAGTAGGG + Intronic
1039883901 8:41644879-41644901 TATCATAAGAAAAATAAGAAGGG - Intergenic
1040345669 8:46490519-46490541 GAGCAGAAGAAAAATTAAAATGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1041318337 8:56587621-56587643 TTGGAGAACCAACATGAGAAAGG + Intergenic
1041850765 8:62389434-62389456 TAGGAAATGAAAAGAGAGAAAGG + Intronic
1041899929 8:62970946-62970968 CAGAAAAAGAAAAATGACAATGG + Intronic
1042098246 8:65243218-65243240 GAGGAAAAGTAAAAGGAGAAGGG - Intergenic
1042138850 8:65659212-65659234 TAGTAGTAGAAAAATAAGAGTGG - Intronic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042975212 8:74461115-74461137 TAAGAGCAGAAAAATGAAGAGGG - Intronic
1043140765 8:76587094-76587116 GTGGAGAAGAAACATGTGAAAGG + Intergenic
1043162081 8:76858187-76858209 TAGGTGAAAGAAAGTGAGAAAGG + Intronic
1043196963 8:77307336-77307358 AAGGAGAATCAAAAAGAGAATGG + Intergenic
1043385585 8:79744628-79744650 AAGGAGAAGTAAAAGGAGAAGGG + Intergenic
1043680391 8:83018119-83018141 TATAAAAAGAAAAATAAGAATGG - Intergenic
1043707898 8:83377048-83377070 TAGGAGAAAAAAATTGCCAATGG - Intergenic
1043730192 8:83668365-83668387 TCAGGGCAGAAAAATGAGAAAGG - Intergenic
1044149801 8:88761412-88761434 TAGGACAGGAAAAATGAAACAGG + Intergenic
1044297933 8:90549840-90549862 AGAGAGGAGAAAAATGAGAAAGG + Intergenic
1044306167 8:90643923-90643945 AAAGAAAAGAAAAAAGAGAAAGG + Intronic
1044340160 8:91037598-91037620 TAGGAGAAGAAAAATAGTCATGG - Intronic
1044364148 8:91323799-91323821 AAAGATAAGAAAAAAGAGAAAGG - Intronic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1044899250 8:96926522-96926544 AAGAAGAAGAAAAAGAAGAAAGG - Intronic
1045066713 8:98453878-98453900 TAGGAAAAGAAAAAAGGGCAGGG + Intronic
1045131091 8:99153815-99153837 AGAGAGAAGAAAAATGATAAAGG - Intronic
1045184363 8:99821570-99821592 TAGAAGAAGTAATATGAAAAAGG - Intronic
1045186862 8:99846913-99846935 TAGGAAAAGGAATATGAGATGGG + Intronic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1045662454 8:104452324-104452346 TAGGTGAAGAAAACAGAGACAGG + Intronic
1045812378 8:106237935-106237957 TAAGAGAAGAAAAAGGAGTAGGG + Intergenic
1046001914 8:108431884-108431906 AAAGAGAAAAAAAATGTGAATGG + Intronic
1046155748 8:110287785-110287807 TAAGAGTAGAAAATTCAGAAAGG + Intergenic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1046353761 8:113050980-113051002 TGGGAGAAGGGAAGTGAGAAAGG + Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046560870 8:115835932-115835954 TTGAAGAGGAAAGATGAGAAAGG + Intergenic
1046669835 8:117045182-117045204 TAGGAGAAGAATAAGGCTAATGG - Intronic
1047073404 8:121373185-121373207 TACAAGAAGAGAAATGACAAGGG + Intergenic
1047106671 8:121738912-121738934 TAGAAGATAAAATATGAGAAGGG + Intergenic
1047536323 8:125723407-125723429 TAGGAGAACAAATAGGAGATAGG - Intergenic
1047788122 8:128174340-128174362 GAGGAGAAGACATCTGAGAAAGG + Intergenic
1047924073 8:129665693-129665715 TAAAAGAAGAAAAACCAGAAGGG + Intergenic
1048224495 8:132571583-132571605 GAGGAGAAGAGAGAGGAGAAAGG + Intergenic
1048355878 8:133653782-133653804 TAGGAGAAGGAAAACCAGAGAGG + Intergenic
1048412430 8:134189228-134189250 AGAGAGAAAAAAAATGAGAAAGG - Intergenic
1048463738 8:134644275-134644297 GAGGAGAGGAAAGATAAGAAAGG + Intronic
1048742699 8:137579837-137579859 GGGGAAAAGAAAAATCAGAAAGG - Intergenic
1049231245 8:141484296-141484318 TAAGGTAAGAAAAAGGAGAAGGG - Intergenic
1049954797 9:682646-682668 AAGGAGGAGAAAAATGACCAGGG - Intronic
1050107389 9:2179378-2179400 TAGGAGAGGAAAAAAGAAAGTGG + Intronic
1050631300 9:7561532-7561554 TAGGGAAATAAAACTGAGAAAGG + Intergenic
1050677621 9:8073734-8073756 AAAGAGAAAAAAAATGAAAACGG + Intergenic
1050766473 9:9141095-9141117 GAGGAGAAGGAAGAAGAGAAGGG - Intronic
1050874225 9:10614304-10614326 TATGAAAAGAAAAAGGTGAAGGG - Intergenic
1050899178 9:10923566-10923588 AAGCAGAAGAAATATGAGAAAGG - Intergenic
1051517746 9:17949680-17949702 CTGGAGAAGAAAGATAAGAAAGG - Intergenic
1051603936 9:18901659-18901681 TAGCCAAAGAAGAATGAGAAAGG + Intronic
1051672129 9:19521489-19521511 TAGGAGATGCTAAAGGAGAATGG - Intronic
1051955543 9:22688493-22688515 AAGGAAAAAAAAAAAGAGAAGGG - Intergenic
1052013427 9:23438037-23438059 TACAAGAAGAAAAAGGAAAAAGG - Intergenic
1052037200 9:23696121-23696143 GAGGAGAAGAAAGATTAGAGTGG - Intronic
1052088946 9:24303263-24303285 CAGAAGGAGAAAAATGAGAAAGG - Intergenic
1052166439 9:25336026-25336048 TACGAGATGAAAAATTAGACAGG + Intergenic
1052170445 9:25389329-25389351 GAGGAGTAGAATCATGAGAAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052200791 9:25777119-25777141 AATGAGAAGAAAAATGAAAGTGG + Intergenic
1052216817 9:25976068-25976090 GATGAGAACAAAAAGGAGAAGGG - Intergenic
1052607623 9:30724698-30724720 CAGGAGAAGAAAAAAAAGAAAGG + Intergenic
1052781656 9:32787294-32787316 TGGGAGAAGAAACATGAAATAGG - Exonic
1053022802 9:34707704-34707726 GAGGAGAAGAAGAAGAAGAAAGG - Intergenic
1053050844 9:34959045-34959067 ATGGAGAAGAAAAATCCGAATGG - Intronic
1053302048 9:36959186-36959208 TAAGATAAGAAGAATGAGAAGGG - Intronic
1053483969 9:38438182-38438204 TATGAGAACAAGAATGTGAAAGG + Intergenic
1053627558 9:39890918-39890940 TTTGAGTAAAAAAATGAGAAAGG + Intergenic
1053778435 9:41575105-41575127 TTTGAGTAAAAAAATGAGAAAGG - Intergenic
1053943940 9:43285494-43285516 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1054216329 9:62359785-62359807 TTTGAGTAAAAAAATGAGAAAGG - Intergenic
1054408019 9:64778821-64778843 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1054671152 9:67795558-67795580 TTTGAGTAAAAAAATGAGAAAGG + Intergenic
1054991429 9:71331751-71331773 AAGGGGGAGAAAAAGGAGAAGGG + Intronic
1055080374 9:72262832-72262854 TATGAAAATAAAAATGAGAAAGG - Intergenic
1055382143 9:75719377-75719399 AAGGAGAAGAACAGAGAGAAGGG + Intergenic
1055468740 9:76590976-76590998 AAGGAAAAGAAAAGGGAGAAAGG + Intergenic
1055838525 9:80474416-80474438 TAAGAAAAAAAAAATGAGGAGGG + Intergenic
1055957604 9:81788797-81788819 CAGGAGGACAAAAATAAGAAGGG - Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056128260 9:83558364-83558386 TTGGAGAAGTAAAGTGAAAATGG + Intergenic
1056290484 9:85138509-85138531 CAGGAGAAGAGAAATGAAAGGGG + Intergenic
1056304188 9:85273098-85273120 TAGGACAATAAAAAGGGGAAAGG + Intergenic
1056491143 9:87108293-87108315 TAGGTGAAGAAAGGTGAAAAAGG + Intergenic
1056838142 9:89974581-89974603 TGGGAGAAGAATAATTTGAAGGG + Intergenic
1057865044 9:98673890-98673912 GAGGAGGAGATAAATGATAATGG + Intronic
1058095150 9:100851678-100851700 TAGGACAATAAAACTGAGAATGG - Intergenic
1058163555 9:101595234-101595256 TGAGAGAAGGAAAAAGAGAAGGG - Intronic
1058170436 9:101674123-101674145 TAAGAGATGAAAAATAAGGAGGG + Intronic
1058271609 9:102979258-102979280 CATGAGATGAAAAATGAAAAGGG + Intergenic
1058387524 9:104455898-104455920 AAAGAGAAGAAAAATTAAAATGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058448085 9:105071463-105071485 TAAGTGAAGAAAAATGAGATGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058855768 9:109060629-109060651 TAGAAGCAAAAACATGAGAAAGG - Intronic
1059316760 9:113432187-113432209 CAAGAAAAGAAAAATGAAAAAGG - Intergenic
1059375462 9:113876894-113876916 TAGAAAAAAAAAATTGAGAAAGG - Intronic
1059568112 9:115404097-115404119 AAGGAGAAGAAAAAGAAGAGGGG - Intergenic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1059932642 9:119276337-119276359 TATGAAAAGAAAAATCAGGAAGG - Intronic
1059992828 9:119881415-119881437 TAGGAGGACAAAGAGGAGAAAGG + Intergenic
1060135690 9:121151367-121151389 AAGAAGAAGAAAAAAGAAAAAGG - Intronic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060181503 9:121537597-121537619 TGGGAGAAGAAAAACAAGAAGGG + Intergenic
1060240371 9:121897877-121897899 AAGGAGAGGAGAAAAGAGAAGGG - Intronic
1060451011 9:123739917-123739939 TAGGAGAAAAAAAAAAAAAAAGG + Intronic
1060705204 9:125792371-125792393 GAGGTGAAGGAAAATGAGAATGG + Intronic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1060749072 9:126156906-126156928 TAAGGGAAGAAAAATAACAAAGG + Intergenic
1060761899 9:126260089-126260111 TTCAAGAGGAAAAATGAGAAAGG - Intergenic
1060797204 9:126520975-126520997 AAGTAGAAGAAAAACCAGAAAGG + Intergenic
1061381164 9:130258681-130258703 TTGGAGAAAAAAAAAAAGAAAGG + Intergenic
1061890121 9:133614880-133614902 TGGGAGCAGAGAAAGGAGAATGG + Intergenic
1062251172 9:135594990-135595012 TTGGATAAGAGCAATGAGAAAGG - Intergenic
1203457223 Un_GL000220v1:982-1004 TAGGAAAAAAAAAGTTAGAATGG + Intergenic
1203587075 Un_KI270747v1:14071-14093 AAAGAAAAGAAAAAAGAGAAAGG + Intergenic
1203616252 Un_KI270749v1:68619-68641 AAAGAAAAGAAAAAAGAGAAAGG - Intergenic
1185502515 X:608482-608504 GAAGAGAAGAAAAAGGAGAGAGG - Intergenic
1185535127 X:854999-855021 GAGGAGAAGAAGACAGAGAAAGG - Intergenic
1185617546 X:1432525-1432547 TCGGACAAGAAAAGGGAGAAAGG + Intronic
1185637477 X:1563520-1563542 AAGAAAAAGAAAAAAGAGAAAGG + Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1185757441 X:2662901-2662923 TAGGGGAAGAATCATGGGAAAGG + Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185931720 X:4211146-4211168 TAGCATAAGACCAATGAGAAGGG - Intergenic
1185989764 X:4880557-4880579 TCTGAAAAGAAAAATGAGCATGG + Intergenic
1186047291 X:5550339-5550361 GAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1186222023 X:7359413-7359435 GAGGAAAGGAAAAATGAGAATGG + Intergenic
1186303842 X:8232185-8232207 TCGGAGAAGATAGATGAAAATGG + Intergenic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1186506693 X:10099269-10099291 GAGGAGAAGAATATTGAAAACGG - Intronic
1186601492 X:11042277-11042299 TAGGAGGACAAAAAAGAAAATGG - Intergenic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1186949550 X:14608223-14608245 AAGGAGAAAAAAAGTGGGAAGGG + Intronic
1187018986 X:15360173-15360195 TAAGGGATGAAAAAGGAGAAAGG - Intronic
1187466972 X:19536460-19536482 TAGAAAGAGAAAAATAAGAATGG + Intronic
1188058865 X:25575777-25575799 TAGTAGAAGAAAACTGAGAATGG + Intergenic
1188632473 X:32382610-32382632 TAGGAAAAAAAAAAATAGAAGGG - Intronic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189457904 X:41210955-41210977 AAGGAAAAGAAAAAGGAGAAAGG - Intronic
1189512004 X:41672161-41672183 TGGGAGGTGAAAAAGGAGAAGGG + Intronic
1190168997 X:48096668-48096690 TAGGAGAAAAAAAATTGTAAAGG + Intergenic
1190414502 X:50167531-50167553 TAGGAGAAGATAAATCTGGAGGG + Intergenic
1190541720 X:51484271-51484293 TAATGGAAGATAAATGAGAATGG - Intergenic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1190894104 X:54598910-54598932 TATGAGGAGAAGAAAGAGAATGG + Intergenic
1191005692 X:55709116-55709138 TGGGAGTTGAAAAATGACAATGG - Intergenic
1191110715 X:56801480-56801502 TTGCAGAACAAAAGTGAGAAAGG + Intergenic
1192093504 X:68185667-68185689 TAAGAGAAAAAAAAAGAGAAAGG + Intronic
1192166636 X:68830826-68830848 AAGGAGAAGAAAGAAAAGAAAGG - Intronic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193407862 X:81124354-81124376 TAGGTGAAGATATTTGAGAATGG - Intronic
1193414174 X:81201858-81201880 GAGGAGAAGAAGAAAGAAAAAGG - Exonic
1193582197 X:83279635-83279657 CAAGTGAAGGAAAATGAGAAAGG + Intergenic
1193601701 X:83514390-83514412 GAGGAGAAGAAAGAGGAGAATGG + Intergenic
1193676333 X:84457215-84457237 TAGGAGAAGTTAAATGTTAATGG - Intronic
1193678780 X:84490906-84490928 TAGGAGAACAAATATGACAATGG - Intronic
1193688888 X:84614415-84614437 TATGTCAAGGAAAATGAGAAAGG - Intergenic
1193875202 X:86854291-86854313 TGGGACAAGAAAAATCACAATGG + Intergenic
1194101704 X:89713527-89713549 CAGAACAAGAACAATGAGAAAGG - Intergenic
1194356174 X:92886954-92886976 TAATAGAATAAAAATGATAATGG + Intergenic
1194760981 X:97795602-97795624 TAAGAAAAGGAAAATGAAAAAGG - Intergenic
1194949556 X:100109058-100109080 TAATAGAAGAAAAAGGGGAAAGG + Intergenic
1195006672 X:100691947-100691969 TAGGGGGTGAAAAATGAGACTGG - Intronic
1195406918 X:104524432-104524454 GAGGAGAAAAAAAAAAAGAAAGG + Intergenic
1195930128 X:110066096-110066118 AAGAAGAATGAAAATGAGAAAGG - Intronic
1196296910 X:114008360-114008382 TAGGAAAAAAAATATTAGAAAGG - Intergenic
1196323025 X:114366142-114366164 TAAGAGAAGAGAAAAGATAATGG + Intergenic
1196387661 X:115175768-115175790 TAGGACAAGGCATATGAGAAGGG - Intronic
1196689001 X:118539012-118539034 TCCAAGAAGAAAGATGAGAAGGG - Intronic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1196848797 X:119918032-119918054 GAGGAGAAGCAAGATCAGAATGG - Intronic
1197075199 X:122344673-122344695 TAAGAGAAGAATATTGGGAAAGG + Intergenic
1197176498 X:123491767-123491789 AAGAAGAAGAAAAATGGGAGTGG + Intergenic
1197320438 X:125022859-125022881 TAAGAAAAGAGAAATGAAAAAGG - Intergenic
1197335338 X:125204513-125204535 GAGGAGGAGAAAGAGGAGAAGGG + Intergenic
1197555551 X:127948146-127948168 GAAGAGAAAAAAAATGAAAAGGG - Intergenic
1198139848 X:133791781-133791803 AAGGAAAAGAAAAAGGAAAAAGG - Intronic
1198227670 X:134660622-134660644 AAAGAGATGAAAAATAAGAAAGG + Intronic
1198230449 X:134684099-134684121 TGGGAGAAGGAGACTGAGAATGG + Intronic
1198237303 X:134747345-134747367 GAAGAGAAGATAAATGAGGAGGG + Intronic
1198700045 X:139386980-139387002 TAGGAGATGGATGATGAGAAGGG + Intergenic
1199239811 X:145533393-145533415 TAGTTGAAGAAAAATTAGAACGG - Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199322897 X:146462371-146462393 TAAGGGAAGAATCATGAGAAAGG - Intergenic
1199535299 X:148895873-148895895 TGGGAGAAGAAATATTAGAGAGG - Intronic
1200074170 X:153543147-153543169 GAAGAGAAGAAAGATAAGAAAGG + Exonic
1200340739 X:155392600-155392622 TGTGAAAAAAAAAATGAGAATGG - Intergenic
1200454652 Y:3374611-3374633 CAGAACAAGAACAATGAGAAAGG - Intergenic
1200664467 Y:6003621-6003643 TAATAGAATAAAAATGATAATGG + Intergenic
1201329795 Y:12805368-12805390 TCTGAATAGAAAAATGAGAAAGG + Intronic
1201479076 Y:14418056-14418078 TTGGAGAACAAATATGAGAAGGG + Intergenic
1201629668 Y:16056266-16056288 AAGGAAAAGATAAATGAGCAAGG - Intergenic
1201634223 Y:16104434-16104456 CAGGAGAAGAAATAAGACAAAGG - Intergenic
1201931719 Y:19357385-19357407 TAGCAGAAAAACAATGAGTATGG + Intergenic
1202060970 Y:20887553-20887575 TGGGAACTGAAAAATGAGAACGG + Intergenic
1202064720 Y:20926195-20926217 TAAGAGAAGAAAAACAATAAAGG - Intergenic
1202085520 Y:21132845-21132867 TAGGAGAGGAAACAAGAGAGAGG + Intergenic
1202101136 Y:21309236-21309258 AAGGAGAAGAAAAAAGGGAAAGG + Intergenic
1202173842 Y:22079554-22079576 TAGGGGAAGAATCATGGGAAAGG - Intronic
1202217518 Y:22506828-22506850 TAGGGGAAGAATCATGGGAAAGG + Intronic
1202325667 Y:23689231-23689253 TAGGGGAAGAATCATGGGAAAGG - Intergenic
1202370440 Y:24192331-24192353 TAGGAGAAGGAATCTGAGCAGGG - Intergenic
1202500344 Y:25477786-25477808 TAGGAGAAGGAATCTGAGCAGGG + Intergenic
1202545104 Y:25980823-25980845 TAGGGGAAGAATCATGGGAAAGG + Intergenic