ID: 947252370

View in Genome Browser
Species Human (GRCh38)
Location 2:228122208-228122230
Sequence GATGCTGCACTGCTGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947252370 Original CRISPR GATGCTGCACTGCTGGAACT AGG (reversed) Intronic
901363573 1:8726246-8726268 GAGGCAGAACTGCTTGAACTCGG - Intronic
901829862 1:11885823-11885845 GAGGGTGCACTGCTGGAATGGGG - Intergenic
903625117 1:24724908-24724930 GATCCTGCACTGCTGGACACTGG - Intergenic
903853191 1:26320562-26320584 GCTGCTGCACAGCTGGCTCTTGG - Intergenic
904339630 1:29826446-29826468 GATGCTGCCCTTGGGGAACTAGG + Intergenic
908122480 1:60999344-60999366 GAGTCTGCCCTGGTGGAACTAGG + Intronic
909264379 1:73537709-73537731 GATGCAGCACTGATGGGAGTGGG + Intergenic
910982537 1:92973312-92973334 GATGCTGCACTGATTCAACTTGG + Intergenic
911292253 1:96071379-96071401 GACTCTGCAGTGCTGGTACTGGG - Intergenic
912558724 1:110535095-110535117 GAAGCTGCTCTGCTTGAATTAGG + Intergenic
912929123 1:113940611-113940633 TATGCTCCACTGCAGGAGCTGGG - Exonic
913101072 1:115566821-115566843 GATACTACAGTGCTGTAACTGGG + Intergenic
915027108 1:152841483-152841505 GATCCTGCCCTGCTGGATTTTGG + Intergenic
915529776 1:156496686-156496708 GCTGCTGCACTGCGGGAGGTGGG - Intronic
918623059 1:186627104-186627126 CATGCTGCACAGCTGAAAGTGGG - Intergenic
920594964 1:207259708-207259730 GATGAGGTACTGCTGGAACTGGG + Intergenic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
1063903848 10:10763119-10763141 GATGCTTGACTTTTGGAACTTGG + Intergenic
1065856284 10:29832844-29832866 GATGCAGCACTGTGGGAAATTGG + Intergenic
1067070097 10:43124892-43124914 GATGCTGCAATGCTGGAAGCAGG + Exonic
1067187341 10:44042386-44042408 GATGCTGCCCTGTGGGATCTGGG - Intergenic
1067582861 10:47456432-47456454 GATGCAGTCCAGCTGGAACTGGG + Intergenic
1073290354 10:102410411-102410433 GCTGCTGCGCTGCAGGAACCCGG - Intronic
1073427246 10:103462769-103462791 GCTGCTGCTCTCCTGGAACACGG + Intergenic
1074833623 10:117267979-117268001 GATGCTCCACTGCTGGGGCTGGG + Intronic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1088493819 11:110413159-110413181 GACGCTGAACTGCTGTAACAAGG + Intergenic
1088717883 11:112564845-112564867 GAGGCTGCAGGGGTGGAACTGGG + Intergenic
1088980996 11:114863570-114863592 GTTGCTGTACTGCAGAAACTAGG + Intergenic
1091114948 11:133004424-133004446 CATGCTGCCTTGCTGGGACTTGG - Intronic
1101862389 12:108493718-108493740 GGGGCTGCCCTGCTGGAGCTGGG - Intergenic
1102275999 12:111582347-111582369 GAGGCAGAACTGCTTGAACTCGG + Intronic
1102986586 12:117283500-117283522 GGAGGTGCACTGCTGGGACTGGG + Intronic
1103807024 12:123581712-123581734 GAGGCAGAACTGCTTGAACTGGG + Intergenic
1105065651 12:133195056-133195078 GCTGCTGCCCTCCTGGAACTGGG - Intronic
1106897590 13:34321384-34321406 GAGACTGCACTGATGGAACAGGG + Intergenic
1107707205 13:43119832-43119854 GATGCTGCACTGCTGATCCTGGG - Intergenic
1114053575 14:18944605-18944627 GGTGCTGCAAGGCTGGGACTCGG - Intergenic
1114108981 14:19457320-19457342 GGTGCTGCAAGGCTGGGACTCGG + Intergenic
1115024681 14:28729372-28729394 GATGCTGCACTTCTTGAACCTGG - Intergenic
1116487490 14:45468004-45468026 GTGCCTGCACTGCTAGAACTAGG - Intergenic
1117170944 14:53094868-53094890 GTTGCTGCATTTCTGTAACTGGG + Intronic
1118138052 14:63049432-63049454 TATGCTTCACTGCTAGAGCTGGG - Intronic
1119777256 14:77256892-77256914 CCTGCTGCCCGGCTGGAACTGGG + Exonic
1120831532 14:89001571-89001593 GAGGCTGCAGAGCTGGGACTGGG - Intergenic
1122099381 14:99395004-99395026 GAAGCTGCCCTGCTGGTCCTGGG - Intergenic
1125873414 15:43123054-43123076 GATGCTGGTGAGCTGGAACTGGG - Intronic
1126056165 15:44731718-44731740 GATGCAGAACTGATAGAACTTGG + Intronic
1127978140 15:64014204-64014226 GAGGCAGCACTGCTGGGACCAGG + Intronic
1128085627 15:64884362-64884384 GATGCCACACTGCTGCCACTTGG - Intronic
1131563595 15:93465195-93465217 GATCCAGCACTTCTGGGACTGGG - Intergenic
1132289777 15:100691560-100691582 GATGCTACATTCCTGGACCTGGG - Intergenic
1132410834 15:101577211-101577233 GATGCTGCTCTGGTGGAGGTTGG - Intergenic
1202971470 15_KI270727v1_random:242083-242105 GATGCTACACTGCTGGTGGTGGG + Intergenic
1132796646 16:1727740-1727762 GAAGCTGCACTGCTGGCGCGGGG - Intronic
1135053460 16:19211361-19211383 GGGGCTGCACTGCTTGATCTTGG + Intronic
1138780337 16:59777762-59777784 GTTGGTGCACTGATGGAATTTGG - Intergenic
1140720205 16:77764656-77764678 GAGGCTGGAGTGCAGGAACTTGG - Intergenic
1146265677 17:31451064-31451086 GGTGCGGCTCTGCTGGGACTGGG - Intronic
1147255684 17:39180166-39180188 GAGGCAGAACTGCTTGAACTAGG + Intronic
1150796196 17:68239259-68239281 GATGCTGCAATCCAGGGACTAGG - Intergenic
1151422865 17:74009862-74009884 GGGGCTGCACTGCTGGCATTCGG - Intergenic
1152132187 17:78484400-78484422 GATGGTGCACAGCTGGAAGCTGG - Intronic
1155593362 18:27453661-27453683 GAGGCTGCACTGCTGGTGGTAGG - Intergenic
1157743322 18:50112800-50112822 GATGTTACACTGCTGAAAATTGG - Intronic
1159051715 18:63426641-63426663 GGGGCTGCACTGCAGGAACTGGG - Intergenic
1159838102 18:73365174-73365196 GAAGCTGACCTGCTGGCACTGGG - Intergenic
1160053346 18:75456590-75456612 GATGCTGCAGTACTGGAAACAGG - Intergenic
1162180556 19:8865943-8865965 CATGCTGCTCTTCTGGAACAAGG + Exonic
1167350100 19:48969104-48969126 GATTCTGGAGTGCAGGAACTTGG + Exonic
1167405110 19:49301629-49301651 GCTGCTGCAGTGCTGGCAGTTGG - Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168138060 19:54364808-54364830 CAGGCTGCACTGCTGGGACCTGG - Exonic
925067646 2:940867-940889 AATGCTGAATTGCTGGCACTTGG + Intergenic
929528172 2:42725769-42725791 GATTCTGCAGTGCTGGAGCAGGG - Intronic
929579746 2:43074327-43074349 GATCCTGCCCTCTTGGAACTTGG + Intergenic
932412334 2:71554801-71554823 GATGCTGCAGTCCTGGCACTTGG + Intronic
932739367 2:74280087-74280109 CATGTTGCAGTGTTGGAACTTGG - Intronic
933170783 2:79122467-79122489 GCTGCTGTACTGCTGGCATTTGG + Intronic
933651203 2:84851789-84851811 AATGGTGCTCTGCTGGTACTGGG + Intronic
937668589 2:124515258-124515280 AATGCTGCCCTGCTGATACTGGG + Intronic
938243116 2:129758238-129758260 CAAGCTGCACTTCTGAAACTAGG + Intergenic
940252471 2:151694340-151694362 GATGCTGCACTCCTTGAAGGTGG - Exonic
946444767 2:219728752-219728774 GAAGCTCCACATCTGGAACTGGG + Intergenic
947252370 2:228122208-228122230 GATGCTGCACTGCTGGAACTAGG - Intronic
1170451032 20:16483953-16483975 GATGCTGCATTGTAGGAACTTGG - Intronic
1171361779 20:24590939-24590961 AGAGCTGCACTGCTGGGACTTGG + Intronic
1172510799 20:35499652-35499674 AGTGATGCACTGTTGGAACTAGG + Intronic
1173221058 20:41133556-41133578 GAGGCAGGACTGCTTGAACTCGG + Intergenic
1173710491 20:45151382-45151404 GATGTTGCATTGTTGGATCTAGG + Intergenic
1179031472 21:37724014-37724036 GATTCTGCACTGCTGGTATGCGG + Intronic
1180094414 21:45549474-45549496 AAGCCTGCACTGCTGGAAGTGGG + Intergenic
1180472045 22:15666986-15667008 GGTGCTGCAAGGCTGGGACTCGG - Intergenic
1180983005 22:19888146-19888168 GGTGCTGCACTGCTGGGCCTGGG - Intronic
1181852522 22:25760316-25760338 GAGGCAGAATTGCTGGAACTGGG + Intronic
1182365352 22:29775227-29775249 GAGGCAGAACTGCTGGAACCCGG - Intergenic
1182697265 22:32205812-32205834 GGTGCTACACTGCTGGCAGTGGG + Intergenic
1183479935 22:38057868-38057890 GCTCCTATACTGCTGGAACTTGG - Intronic
1183750686 22:39718703-39718725 CATGGTGCCCGGCTGGAACTGGG - Intergenic
1184888725 22:47366575-47366597 GTTGCTGCCATGCTGGGACTGGG - Intergenic
1184974364 22:48050744-48050766 GAAGCTGCATGGCTGGACCTGGG + Intergenic
951072806 3:18351994-18352016 GAATCTGCTCTGCTGGAACATGG + Exonic
953758182 3:45665804-45665826 GAAGCTGCACTGCTGGAGAGAGG + Intronic
954199861 3:49017835-49017857 GATCCCGCACAGCTGGCACTAGG + Exonic
954655029 3:52189231-52189253 GATGCTGATAAGCTGGAACTTGG + Intergenic
957852517 3:85828008-85828030 TATGCACCACTTCTGGAACTGGG - Intronic
958712588 3:97735996-97736018 GATGCTCCACTGCTGGCAGAAGG + Exonic
959730813 3:109599602-109599624 GACAATGCACTGCTGGAACATGG - Intergenic
960239561 3:115324605-115324627 AAACCTGCACTGCAGGAACTAGG - Intergenic
960807187 3:121595329-121595351 GATGCTGTCCTGGTGAAACTAGG + Intronic
966292618 3:178378038-178378060 GAAGCTGGACTGCAGGAATTGGG + Intergenic
969612054 4:8232867-8232889 GATGCTGCTCTGCTGGTCCAGGG - Intronic
969649735 4:8458555-8458577 GAGGCTGAACTGCTTGAACCTGG - Intronic
970121289 4:12755598-12755620 AATGCAACACTGCTGGAAGTTGG + Intergenic
970220481 4:13805393-13805415 GATTCTGCACTTCTCAAACTGGG - Intergenic
973863510 4:55088942-55088964 CATGCTGGACTGCTGGCACGGGG - Exonic
982655546 4:158144688-158144710 CATGCTGAACTGGTGGATCTAGG - Intronic
984836569 4:184028012-184028034 TATGCTGCACTGTTAGAACTTGG + Intergenic
987987332 5:25163886-25163908 TATGCTGTACTGCTGGAAAATGG - Intergenic
991636068 5:68707216-68707238 GATGCTGCACAGCCAGGACTAGG + Intergenic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
996651158 5:125878807-125878829 GATGCTTTTCTGCTGGAACTTGG - Intergenic
999999268 5:157121317-157121339 GGTGCAGCTCTGCTGGAAGTGGG - Intronic
1004850788 6:19697247-19697269 GAGGCTGAACTGCTTGAACTCGG - Intergenic
1009039239 6:58157694-58157716 TGTGCTGAGCTGCTGGAACTGGG + Intergenic
1009215138 6:60912537-60912559 TGTGCTGAGCTGCTGGAACTGGG + Intergenic
1015477565 6:133670643-133670665 GAAGCTGCAGTGGTGCAACTTGG + Intergenic
1022046561 7:26626765-26626787 AATGCTGCTTTGCTGGAACAAGG + Intergenic
1023411175 7:39890715-39890737 GGTATTGCACTGTTGGAACTTGG + Intergenic
1026898405 7:74023704-74023726 GAGGCTGAAATTCTGGAACTCGG - Intergenic
1028744755 7:94315333-94315355 GATGCTGTTTTCCTGGAACTGGG - Intergenic
1032576152 7:133057162-133057184 GATGCTGCAGGGCTGGGAATAGG + Intronic
1032800871 7:135316452-135316474 CACGTTGCTCTGCTGGAACTGGG - Intergenic
1035154833 7:156903988-156904010 GATGCTGAATTGCTTGAACCCGG + Intergenic
1035234407 7:157487254-157487276 GAGGCTGCACTGGTGGGGCTGGG + Intergenic
1039454566 8:37698260-37698282 GCTGCCGCACAGCTGCAACTGGG + Exonic
1044876342 8:96671019-96671041 GATGCTGCACTGGGGAAACTGGG + Intronic
1045228563 8:100276656-100276678 GAGGCAGAACTGCTTGAACTTGG + Intronic
1045840745 8:106577803-106577825 GAAGCTGCAAGGCCGGAACTGGG + Intronic
1047666238 8:127094979-127095001 AGTGCTGCACTGCTGGTACGTGG + Intergenic
1049454697 8:142680988-142681010 GAAGCTGCAGTGCTGGGACTGGG - Intronic
1049871269 8:144979468-144979490 GAGACTGCACTGCTTGAACAGGG + Intergenic
1050302005 9:4268785-4268807 GATGCTGCCCAGCTGGTACTGGG - Intronic
1051404009 9:16714435-16714457 GATGCTGAACTTCTTGAACATGG + Intronic
1052022109 9:23537714-23537736 GCTGCTTCACTGCTGGTCCTTGG - Intergenic
1052651373 9:31307096-31307118 TATGCTGCACTCCTGGATCTGGG + Intergenic
1053069034 9:35090097-35090119 TATGCAGCACTGCTGCAGCTGGG - Exonic
1055728177 9:79253960-79253982 GATGCTGCACAGCTGGTGATGGG - Intergenic
1058122956 9:101158815-101158837 GATACTGCACAGCTGGGAGTTGG + Intronic
1058717494 9:107736096-107736118 GTTGCTGAACTGCAGAAACTGGG - Intergenic
1058995875 9:110298335-110298357 GAGTCTGCAGTGCTGGAATTTGG - Intergenic
1061578649 9:131523404-131523426 GAGGCTCCACTGCTGGCCCTGGG - Exonic
1191062211 X:56310645-56310667 GAAGCTGCACTGCTGGCCCAAGG + Intergenic
1195656052 X:107332484-107332506 CCTGCTGGGCTGCTGGAACTAGG - Intergenic
1196677782 X:118438880-118438902 GAGGCAGAACTGCTTGAACTCGG - Intronic
1196809453 X:119617464-119617486 GATGCTGCAAGGCTGGAACGGGG - Intronic
1197716782 X:129714885-129714907 CATGCTGCTCTCCTGGAACCGGG + Intergenic
1198084529 X:133269563-133269585 CATTCTGCACTGATGGGACTTGG - Intergenic
1199964426 X:152807731-152807753 GACGCTGCACTGCAGGCCCTGGG - Intergenic
1200051028 X:153431841-153431863 AATGCTGGAGTCCTGGAACTTGG - Intergenic