ID: 947253963

View in Genome Browser
Species Human (GRCh38)
Location 2:228140861-228140883
Sequence CTGGAAGCTTATAATCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6040
Summary {0: 1, 1: 4, 2: 101, 3: 1089, 4: 4845}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947253963 Original CRISPR CTGGAAGCTTATAATCATGA TGG (reversed) Intronic
Too many off-targets to display for this crispr