ID: 947255584

View in Genome Browser
Species Human (GRCh38)
Location 2:228160198-228160220
Sequence TTGTATAATCATGGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947255584 Original CRISPR TTGTATAATCATGGGGAAGA TGG (reversed) Intronic
902675730 1:18007465-18007487 TTGGATATTCATGGGAAGGATGG - Intergenic
906814639 1:48866515-48866537 TCTTATGATCATGGGGATGATGG - Intronic
907608006 1:55839003-55839025 TTCTATACTCATGGTGAAGCTGG + Intergenic
907878441 1:58518687-58518709 TAGTATATTCATTGGGAAAAGGG + Intronic
912012247 1:104981953-104981975 TTGCATAATCAATGGGAGGAAGG + Intergenic
912376424 1:109213549-109213571 TTGTATCAAGATGGAGAAGACGG + Intergenic
912689079 1:111790414-111790436 TTACATCATCATGGGAAAGAGGG - Intronic
913062713 1:115222615-115222637 TCTCCTAATCATGGGGAAGAGGG + Intergenic
916379497 1:164193852-164193874 TTGAATAACCATGGGGAAAGTGG - Intergenic
917336476 1:173928904-173928926 TTGAAAAATCATGGGGGAGCGGG - Intergenic
917818951 1:178741312-178741334 TTGTATAACCTTGGGCAAGTTGG - Intronic
918491531 1:185086377-185086399 TAGTATAAATATGGGAAAGAGGG - Intronic
919439856 1:197618814-197618836 TTGTATAATAATAGAGAAAACGG - Intronic
921355289 1:214280225-214280247 TTACATAATCATGTGGAACACGG + Intergenic
922129041 1:222758566-222758588 CTGTATAAACATGGGGTGGAGGG - Intergenic
923585474 1:235266030-235266052 GTGTATATACGTGGGGAAGAGGG + Intronic
924799649 1:247318927-247318949 CTGCATTATAATGGGGAAGAAGG + Intronic
1062970903 10:1648478-1648500 TTGTAAAACTATGGGGGAGATGG - Intronic
1063426122 10:5951432-5951454 TTGTACAGCCAGGGGGAAGAGGG - Intronic
1063946315 10:11179797-11179819 TTGTACAAACAGGGGGAAGGAGG + Intronic
1064454084 10:15470464-15470486 TGAAATAACCATGGGGAAGAAGG - Intergenic
1064601091 10:16993848-16993870 TTGTATGATCATGAGAAAGAGGG + Intronic
1067717788 10:48703099-48703121 ATGTGAAACCATGGGGAAGAGGG + Intronic
1070048843 10:72866698-72866720 TTATAAATACATGGGGAAGATGG + Intronic
1070312129 10:75281589-75281611 TTGTAAAATCATTGGGAAGGGGG - Intergenic
1071964351 10:90836856-90836878 TTCTATCATCATGAGGAATATGG + Intronic
1076718587 10:132382001-132382023 TTGTACAACCAAGGAGAAGATGG - Intergenic
1078266957 11:9762201-9762223 TTGTGTGAACATGGGGAGGATGG + Intergenic
1081721201 11:45289950-45289972 TTATATTCCCATGGGGAAGACGG + Intergenic
1081979991 11:47260298-47260320 TTGTATAATGAAGGGAATGAAGG + Intronic
1082204899 11:49421327-49421349 TTTTATAATCTTGGGGAAGAGGG + Intergenic
1086650196 11:89279200-89279222 TTTTATGATCTTGGGGAAGAGGG - Intronic
1089086451 11:115821717-115821739 TTGTAAAATCATTGGGAAACTGG + Intergenic
1089152087 11:116372094-116372116 TTGGACAAGTATGGGGAAGAGGG - Intergenic
1089294960 11:117461860-117461882 TGGTTAAATCCTGGGGAAGAAGG + Intronic
1089803328 11:121057592-121057614 TTGAAAATACATGGGGAAGAAGG + Intronic
1090183783 11:124722771-124722793 TTTTTTAAACATGGGGAAGCTGG - Intergenic
1090568713 11:128024299-128024321 TTGTTTTATCAAAGGGAAGAAGG + Intergenic
1093215961 12:16361446-16361468 AAATGTAATCATGGGGAAGAAGG + Intronic
1093833970 12:23802943-23802965 TTGGAGAATGTTGGGGAAGAGGG - Intronic
1094028924 12:25988590-25988612 TTGTTTAGTCATGAGGGAGAGGG - Intronic
1099001149 12:77179422-77179444 TTGAAAAATCATGGAGAAGCGGG - Intergenic
1099193273 12:79583082-79583104 TGGTCTAAGAATGGGGAAGAAGG + Intronic
1101645348 12:106626446-106626468 TTGAAGAATCATGGGAAATAGGG + Intronic
1106206517 13:27601322-27601344 TTCTTTAATGATGGGGAAGAGGG - Intronic
1108208757 13:48117500-48117522 TCCTAGAATCATTGGGAAGAAGG + Intergenic
1108976606 13:56451851-56451873 TTATATCACCATGGGAAAGATGG - Intergenic
1111473326 13:88715140-88715162 TTGTATTCTCATGTGGTAGAAGG - Intergenic
1113324898 13:109271623-109271645 CAGCAAAATCATGGGGAAGAAGG + Intergenic
1114338926 14:21722842-21722864 ATGTATTATGATGGGGAAAAGGG - Intergenic
1115079668 14:29435736-29435758 CTGTATACTCATAGGGAAGCTGG - Intergenic
1116612708 14:47097503-47097525 TTGTATTTTCATGGTGAAGATGG + Intronic
1118391719 14:65301408-65301430 TTAAATAATCCTGGGGAAGTAGG + Intergenic
1118964889 14:70571589-70571611 TTGTATAGGCATGGGGAGAATGG - Intergenic
1120086327 14:80278312-80278334 TTGGATATAGATGGGGAAGAGGG + Intronic
1124359724 15:29027033-29027055 TTATATCATAAAGGGGAAGATGG - Intronic
1128004711 15:64228108-64228130 TTTTAAAATAATGGGGGAGAGGG - Intronic
1131831848 15:96359690-96359712 TTGGATAGTCAAGGGGGAGAGGG - Intergenic
1134537864 16:15041183-15041205 TTGTATAATAAAGGCGAAGGAGG + Intronic
1134559166 16:15192946-15192968 TTATATATTCATGGGGAGGCAGG - Intergenic
1134919701 16:18104559-18104581 TTATATATTCATGGGGAGGCAGG - Intergenic
1135819661 16:25672045-25672067 TTGTATAATCAAGAGGAAATGGG + Intergenic
1138034532 16:53590969-53590991 TTGGATAAAGATGGGGAAGGGGG + Intergenic
1144387479 17:14762785-14762807 GTGTATATTCATGGGGTACATGG - Intergenic
1146368587 17:32249445-32249467 GTTAATAATGATGGGGAAGATGG - Intronic
1149742678 17:59062409-59062431 TTGTCTAATATGGGGGAAGAAGG + Intronic
1150062975 17:62084721-62084743 CTGCAGTATCATGGGGAAGAAGG + Intergenic
1153493917 18:5677976-5677998 TTTTGTAATGATGGGGGAGAGGG - Intergenic
1153630901 18:7068927-7068949 TTGTATATTTATGGGAAAAAAGG - Intronic
1154957186 18:21270375-21270397 TTGGAGAATCATGGGGAAGGTGG + Intronic
1156827333 18:41447239-41447261 TTAGATAATTATGGAGAAGAAGG - Intergenic
1157316441 18:46593811-46593833 TCATATTACCATGGGGAAGAAGG + Intronic
1158795871 18:60846130-60846152 TTTTATAATCATGTTTAAGAGGG - Intergenic
1158804295 18:60951177-60951199 TTAGATAATCAGGGGGAAAAAGG - Intergenic
1158910951 18:62061920-62061942 TTGGATAATGGTGGGGAAGTAGG - Intronic
1159119993 18:64157756-64157778 TTGGAAAATCTTTGGGAAGAGGG + Intergenic
1161833288 19:6626094-6626116 TTTTTTAATGATGGGGAAAAAGG - Intergenic
925522914 2:4767653-4767675 TTGTATATTCATTGGCAAGATGG - Intergenic
927020435 2:19011129-19011151 TGGTAGAAACATAGGGAAGATGG + Intergenic
927624210 2:24696329-24696351 TTGTATGAAGAAGGGGAAGATGG + Intronic
931630553 2:64294760-64294782 TTGTAGAATCAGTGGGTAGATGG - Intergenic
933884271 2:86703320-86703342 TTGGAAAATCATGGAGAGGAGGG + Intronic
935654084 2:105406967-105406989 TGTTATAAACATGGGAAAGAAGG - Intronic
936022711 2:109006864-109006886 TTATACAAACATGAGGAAGACGG + Intergenic
937997246 2:127703591-127703613 TTGTTTACTGATGGGGAACAAGG - Exonic
939684821 2:145186240-145186262 TTGTATAAAGGTGGGGAAAAGGG - Intergenic
939718144 2:145611451-145611473 TGGGATAATCATGGGCGAGATGG + Intergenic
941548539 2:166885178-166885200 TTGTTTGTTCATGTGGAAGAAGG + Intergenic
942142159 2:172988195-172988217 GTGTTTAACCAGGGGGAAGAAGG + Exonic
942474044 2:176296618-176296640 TTGTTTTTTAATGGGGAAGAGGG - Intronic
943016538 2:182517330-182517352 TGGAATAAACATGGAGAAGATGG - Intronic
944768916 2:202893543-202893565 TTGAATAATTATGTGTAAGATGG - Intronic
944971661 2:205000514-205000536 TTGTATTCTCATTGGGAAAATGG - Intronic
945621494 2:212145334-212145356 TGGTATAATCATGAGGTAAAAGG - Intronic
947255584 2:228160198-228160220 TTGTATAATCATGGGGAAGATGG - Intronic
947538613 2:230958330-230958352 TTGTAAAATCATGGAGAATGGGG + Intronic
948645867 2:239404054-239404076 GTGTATAATCAGTGGGAAAATGG + Intergenic
1172766517 20:37354060-37354082 TTGTATTAACCTGGGGAAGAAGG + Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1174310984 20:49654241-49654263 ACATATAATCTTGGGGAAGATGG - Intronic
1177247909 21:18553893-18553915 TTGTATCATCATATGGCAGAAGG + Intergenic
1183099707 22:35576364-35576386 TTTTATAATAATGAGGAAGAAGG + Intergenic
949279680 3:2331460-2331482 TGTCATAATCATAGGGAAGATGG - Intronic
951189478 3:19751664-19751686 TTGTTTAATAAAGGGGAAAATGG - Intergenic
952335470 3:32399953-32399975 CTTTTTAATCTTGGGGAAGAGGG - Intronic
952694334 3:36248409-36248431 TTTTAAAATCATGTGCAAGAAGG + Intergenic
954990465 3:54836565-54836587 TTCTAAAATCATGATGAAGAAGG - Intronic
957014600 3:75048251-75048273 TTGTATAATTTGGGAGAAGATGG + Intergenic
963826639 3:149962495-149962517 TTTTATAAAAAAGGGGAAGAGGG - Intronic
964330540 3:155597386-155597408 TTGCAGAATCAAGGGGAAAATGG - Intronic
966698353 3:182817135-182817157 TTATATCATCATTGGGAATATGG + Intronic
967303651 3:188040493-188040515 TTGGAGGATCATGGGCAAGAGGG + Intergenic
967889382 3:194354251-194354273 GTGTATAATCATGGGATAAAGGG + Intergenic
967907936 3:194517175-194517197 TTCTATAACCCTGGGGCAGAGGG - Intergenic
968450351 4:673181-673203 TTGTTTAAAAATGGGGAAGCTGG - Intronic
970540396 4:17072489-17072511 TTCTGTGCTCATGGGGAAGAAGG - Intergenic
971174706 4:24270960-24270982 TTGTATGATCATGGCTAATACGG + Intergenic
971952399 4:33370459-33370481 TTGTATTATCTTGGAAAAGATGG + Intergenic
972042315 4:34618647-34618669 TTGCATAATCATGAAGAATAAGG - Intergenic
972182356 4:36484282-36484304 CTTTATATTCATGGGGAATATGG - Intergenic
972399400 4:38686690-38686712 TTGTATAAGCAGGGACAAGAAGG + Intronic
972581634 4:40400260-40400282 TGGCATCATCAAGGGGAAGAAGG - Intergenic
972837948 4:42896896-42896918 TTGAATATTCATGGGAAACATGG - Intronic
973123113 4:46547605-46547627 TTGGATAATAATGGTGATGATGG - Intergenic
974268506 4:59618149-59618171 TTGGATTATCGTGGAGAAGAAGG + Intergenic
974456851 4:62139346-62139368 TTGTAGAATCATGAAGAAAATGG + Intergenic
974714360 4:65647756-65647778 TTGTATAATTATGATTAAGATGG + Intronic
974863010 4:67546009-67546031 ATGTATAATAATGGTGATGATGG + Intergenic
975874421 4:78819145-78819167 TAGCATAATCAAGGGGAAGGCGG + Intronic
978693943 4:111553050-111553072 TTGTATATTCATAGAGGAGATGG + Intergenic
981850332 4:149222001-149222023 TTGAAAAAAAATGGGGAAGAGGG + Intergenic
981992449 4:150938964-150938986 TGGTATAAGAATGGGGAATAAGG - Intronic
982962911 4:161863243-161863265 GTGTATAATCATGATGAACAAGG + Intronic
983398036 4:167227517-167227539 TTGTAGGATCATGGAGAGGAAGG + Intronic
983605935 4:169583960-169583982 TTATATGCTCATGGAGAAGAAGG - Intronic
984561459 4:181275963-181275985 TTGTATATTCATGTGGCAAAAGG + Intergenic
984671060 4:182488121-182488143 GTGGATAATGATGGGCAAGACGG + Intronic
985293341 4:188408322-188408344 CTGTATAATCTTGGGAAAGTAGG + Intergenic
987481470 5:18464181-18464203 TTGTATCATCATTGGTAAGTAGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988291864 5:29297438-29297460 TTGTATGCTCATGGGGATGGGGG - Intergenic
988692811 5:33589592-33589614 TTGCACAATAATGGAGAAGATGG - Intronic
989518219 5:42368978-42369000 CTGCATCATCATGTGGAAGAAGG + Intergenic
990011940 5:51009843-51009865 TTATAGAATCAAGGGTAAGAGGG - Intergenic
990177219 5:53121500-53121522 TTGTAAAATATTAGGGAAGATGG + Intergenic
995159520 5:108962229-108962251 TTGTGTAAACATATGGAAGATGG + Intronic
995409340 5:111836932-111836954 CTGTATCATCTTGGGGAAAATGG + Intronic
996143234 5:119941194-119941216 TTGGATATTAAGGGGGAAGAGGG - Intergenic
997421488 5:133770928-133770950 TTGGATAGTCATGCAGAAGAAGG - Intergenic
998514202 5:142737898-142737920 TTGTAGAATCATGAGCAAGGTGG + Intergenic
999185607 5:149706065-149706087 ATGTAAAATCTTGGTGAAGAAGG + Intergenic
1000482903 5:161802031-161802053 TAGAATAATCCTGGGGAAGTAGG - Intergenic
1001237680 5:170043950-170043972 TTGTGCAATAATGGGGAAAAAGG + Intronic
1004244494 6:13960110-13960132 GGGTATAGTCATTGGGAAGAAGG + Intronic
1005084080 6:21986068-21986090 TAGTAGTATCATGGGGAAGCTGG - Intergenic
1005753070 6:28901571-28901593 TTGTCTGCTCTTGGGGAAGATGG + Intergenic
1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG + Exonic
1006192239 6:32216772-32216794 TTGTACAACCATGGGGACAAGGG - Intronic
1007145514 6:39626002-39626024 TGGTATAATCATTGTGAGGATGG + Intronic
1008666134 6:53718325-53718347 TTGTATAAAAATGGGGAAGATGG + Intergenic
1009918747 6:70029994-70030016 ATGTATAATCATGGGTAAGTTGG - Intronic
1010704263 6:79089314-79089336 TAGTAAAGTCATGGGGAAAATGG + Intergenic
1011114118 6:83871321-83871343 TTGCATAATCATGTGAAATAAGG - Intronic
1012822007 6:104096883-104096905 TTATATTTTCATGGGAAAGATGG - Intergenic
1012889437 6:104881846-104881868 ATGTATAAATATGGGGGAGATGG - Intergenic
1013921382 6:115408524-115408546 TTGTTTAATCAAAGGGAAAAGGG - Intergenic
1014762245 6:125369294-125369316 TAGCAAAATCATGGGGAATATGG + Intergenic
1015022866 6:128497667-128497689 ATGTATAATAATGGGAAAGAAGG - Intronic
1015866746 6:137734735-137734757 TTGTTTAATAATGAGGAAGATGG - Intergenic
1016354931 6:143208476-143208498 TTATATAATCAGGGGCAGGAAGG + Intronic
1016382130 6:143495366-143495388 CTATATAATCATGGGGGATATGG + Exonic
1016740228 6:147519644-147519666 ATGTAGTCTCATGGGGAAGATGG + Intronic
1018392594 6:163351797-163351819 TTGTAGACTGATCGGGAAGAGGG - Intergenic
1020053946 7:5103891-5103913 ATGTATAAGAATGGGGAAAATGG + Intergenic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1027199622 7:76055243-76055265 TAGTATGAGGATGGGGAAGAGGG + Intronic
1028002782 7:85521673-85521695 TTCTATATTCATGTAGAAGAAGG + Intergenic
1028594715 7:92535962-92535984 TTGTATATTTATGGTAAAGATGG - Intronic
1030582655 7:111377970-111377992 TTTTAAAATCAAGGGGAATACGG + Intronic
1031960411 7:127984384-127984406 TTATATAACCATGGGAAAGTGGG + Intronic
1032215545 7:129954272-129954294 GTGTATATTCATGGGAATGAGGG - Intergenic
1033977822 7:147124293-147124315 CAGTATAATCTTGGGGAAGCAGG - Intronic
1035963001 8:4158059-4158081 TTGTATTGTAATGGGGAAGCAGG - Intronic
1041594895 8:59637925-59637947 TTGTAGAATAATAGGGAAGATGG + Intergenic
1041683979 8:60625470-60625492 TCGTAAAATGATGGGGCAGAGGG + Intergenic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043636743 8:82393791-82393813 TTTTATCATAATGGGGAGGATGG - Intergenic
1045681607 8:104666795-104666817 GGGAATAATCATGGGAAAGAGGG - Intronic
1046017692 8:108625182-108625204 TTTGTTAATCATGTGGAAGAGGG + Intronic
1048600957 8:135918258-135918280 TTTTATAATAATGTGGAAGATGG + Intergenic
1050109391 9:2199488-2199510 ATGTATAATCATGGTGGACAGGG + Intergenic
1051725258 9:20082397-20082419 TTGAATAAACTTGGAGAAGAGGG - Intergenic
1052141143 9:24986088-24986110 TTGTATAAGCATAGGCAAGTTGG + Intergenic
1052262571 9:26534824-26534846 ATGTATAATCATTGGAAAGGAGG + Intergenic
1056913710 9:90726617-90726639 TTCTATAAGCATGGTGCAGATGG - Intergenic
1057644929 9:96865091-96865113 CTGAATAATCATGTGGTAGAGGG + Intronic
1061659580 9:132119993-132120015 GTGTAGAGTCATGGGGAGGAGGG - Intergenic
1186165042 X:6818882-6818904 TTGTTAAATCATGGGAAAGCAGG - Intergenic
1186291846 X:8108830-8108852 TTGTATAATGAGGGGGGTGAAGG - Intergenic
1189684503 X:43549944-43549966 TTCTACATTCAGGGGGAAGAAGG - Intergenic
1193902760 X:87203473-87203495 TTGTATAATCCTGGTCAAGCAGG - Intergenic
1198033260 X:132776102-132776124 TTGTATGATCATGGGGTGGATGG + Intronic
1198500322 X:137238233-137238255 GTTTAGAATCATGGGGAAGTGGG - Intergenic