ID: 947274188

View in Genome Browser
Species Human (GRCh38)
Location 2:228372256-228372278
Sequence CTGTTAGCTTATATGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274188_947274194 3 Left 947274188 2:228372256-228372278 CCATGTACCATATAAGCTAACAG No data
Right 947274194 2:228372282-228372304 TGGGTCCCATAAAAAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274188 Original CRISPR CTGTTAGCTTATATGGTACA TGG (reversed) Intergenic
No off target data available for this crispr