ID: 947274715

View in Genome Browser
Species Human (GRCh38)
Location 2:228377467-228377489
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274715_947274722 15 Left 947274715 2:228377467-228377489 CCCCACGCTTCCCCATTTCTCAG No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274715 Original CRISPR CTGAGAAATGGGGAAGCGTG GGG (reversed) Intergenic