ID: 947274716

View in Genome Browser
Species Human (GRCh38)
Location 2:228377468-228377490
Sequence ACTGAGAAATGGGGAAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274716_947274722 14 Left 947274716 2:228377468-228377490 CCCACGCTTCCCCATTTCTCAGT No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274716 Original CRISPR ACTGAGAAATGGGGAAGCGT GGG (reversed) Intergenic