ID: 947274717

View in Genome Browser
Species Human (GRCh38)
Location 2:228377469-228377491
Sequence CACTGAGAAATGGGGAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274717_947274722 13 Left 947274717 2:228377469-228377491 CCACGCTTCCCCATTTCTCAGTG No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274717 Original CRISPR CACTGAGAAATGGGGAAGCG TGG (reversed) Intergenic