ID: 947274719

View in Genome Browser
Species Human (GRCh38)
Location 2:228377477-228377499
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274719_947274722 5 Left 947274719 2:228377477-228377499 CCCCATTTCTCAGTGCTGGAGAA No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data
947274719_947274723 28 Left 947274719 2:228377477-228377499 CCCCATTTCTCAGTGCTGGAGAA No data
Right 947274723 2:228377528-228377550 CACAATACTTACATAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274719 Original CRISPR TTCTCCAGCACTGAGAAATG GGG (reversed) Intergenic