ID: 947274719 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:228377477-228377499 |
| Sequence | TTCTCCAGCACTGAGAAATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947274719_947274723 | 28 | Left | 947274719 | 2:228377477-228377499 | CCCCATTTCTCAGTGCTGGAGAA | No data | ||
| Right | 947274723 | 2:228377528-228377550 | CACAATACTTACATAAAATAAGG | No data | ||||
| 947274719_947274722 | 5 | Left | 947274719 | 2:228377477-228377499 | CCCCATTTCTCAGTGCTGGAGAA | No data | ||
| Right | 947274722 | 2:228377505-228377527 | TTTGTTTGTTTCAATTTTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947274719 | Original CRISPR | TTCTCCAGCACTGAGAAATG GGG (reversed) | Intergenic | ||