ID: 947274720 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:228377478-228377500 |
Sequence | ATTCTCCAGCACTGAGAAAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
947274720_947274722 | 4 | Left | 947274720 | 2:228377478-228377500 | CCCATTTCTCAGTGCTGGAGAAT | No data | ||
Right | 947274722 | 2:228377505-228377527 | TTTGTTTGTTTCAATTTTCTTGG | No data | ||||
947274720_947274723 | 27 | Left | 947274720 | 2:228377478-228377500 | CCCATTTCTCAGTGCTGGAGAAT | No data | ||
Right | 947274723 | 2:228377528-228377550 | CACAATACTTACATAAAATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
947274720 | Original CRISPR | ATTCTCCAGCACTGAGAAAT GGG (reversed) | Intergenic | ||