ID: 947274720

View in Genome Browser
Species Human (GRCh38)
Location 2:228377478-228377500
Sequence ATTCTCCAGCACTGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274720_947274722 4 Left 947274720 2:228377478-228377500 CCCATTTCTCAGTGCTGGAGAAT No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data
947274720_947274723 27 Left 947274720 2:228377478-228377500 CCCATTTCTCAGTGCTGGAGAAT No data
Right 947274723 2:228377528-228377550 CACAATACTTACATAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274720 Original CRISPR ATTCTCCAGCACTGAGAAAT GGG (reversed) Intergenic