ID: 947274721

View in Genome Browser
Species Human (GRCh38)
Location 2:228377479-228377501
Sequence GATTCTCCAGCACTGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274721_947274723 26 Left 947274721 2:228377479-228377501 CCATTTCTCAGTGCTGGAGAATC No data
Right 947274723 2:228377528-228377550 CACAATACTTACATAAAATAAGG No data
947274721_947274722 3 Left 947274721 2:228377479-228377501 CCATTTCTCAGTGCTGGAGAATC No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274721 Original CRISPR GATTCTCCAGCACTGAGAAA TGG (reversed) Intergenic