ID: 947274722

View in Genome Browser
Species Human (GRCh38)
Location 2:228377505-228377527
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274721_947274722 3 Left 947274721 2:228377479-228377501 CCATTTCTCAGTGCTGGAGAATC No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data
947274719_947274722 5 Left 947274719 2:228377477-228377499 CCCCATTTCTCAGTGCTGGAGAA No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data
947274717_947274722 13 Left 947274717 2:228377469-228377491 CCACGCTTCCCCATTTCTCAGTG No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data
947274720_947274722 4 Left 947274720 2:228377478-228377500 CCCATTTCTCAGTGCTGGAGAAT No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data
947274716_947274722 14 Left 947274716 2:228377468-228377490 CCCACGCTTCCCCATTTCTCAGT No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data
947274715_947274722 15 Left 947274715 2:228377467-228377489 CCCCACGCTTCCCCATTTCTCAG No data
Right 947274722 2:228377505-228377527 TTTGTTTGTTTCAATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr