ID: 947274723

View in Genome Browser
Species Human (GRCh38)
Location 2:228377528-228377550
Sequence CACAATACTTACATAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947274720_947274723 27 Left 947274720 2:228377478-228377500 CCCATTTCTCAGTGCTGGAGAAT No data
Right 947274723 2:228377528-228377550 CACAATACTTACATAAAATAAGG No data
947274719_947274723 28 Left 947274719 2:228377477-228377499 CCCCATTTCTCAGTGCTGGAGAA No data
Right 947274723 2:228377528-228377550 CACAATACTTACATAAAATAAGG No data
947274721_947274723 26 Left 947274721 2:228377479-228377501 CCATTTCTCAGTGCTGGAGAATC No data
Right 947274723 2:228377528-228377550 CACAATACTTACATAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947274723 Original CRISPR CACAATACTTACATAAAATA AGG Intergenic
No off target data available for this crispr