ID: 947275036

View in Genome Browser
Species Human (GRCh38)
Location 2:228381014-228381036
Sequence GGTATTGTATGTATACCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947275034_947275036 2 Left 947275034 2:228380989-228381011 CCTTTTGTGCTTAGTACATAGGA No data
Right 947275036 2:228381014-228381036 GGTATTGTATGTATACCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947275036 Original CRISPR GGTATTGTATGTATACCAAT TGG Intergenic
No off target data available for this crispr