ID: 947279342

View in Genome Browser
Species Human (GRCh38)
Location 2:228431759-228431781
Sequence GAGCAGAACTTTCATCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947279342_947279344 3 Left 947279342 2:228431759-228431781 CCTTCTTGATGAAAGTTCTGCTC No data
Right 947279344 2:228431785-228431807 GTCTGGAAGCTTATCATACTAGG No data
947279342_947279345 4 Left 947279342 2:228431759-228431781 CCTTCTTGATGAAAGTTCTGCTC No data
Right 947279345 2:228431786-228431808 TCTGGAAGCTTATCATACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947279342 Original CRISPR GAGCAGAACTTTCATCAAGA AGG (reversed) Intergenic
No off target data available for this crispr