ID: 947279623

View in Genome Browser
Species Human (GRCh38)
Location 2:228436169-228436191
Sequence AGCAGTTTAAAGGAATGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947279623_947279627 28 Left 947279623 2:228436169-228436191 CCGTACCATTCCTTTAAACTGCT No data
Right 947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG No data
947279623_947279626 -9 Left 947279623 2:228436169-228436191 CCGTACCATTCCTTTAAACTGCT No data
Right 947279626 2:228436183-228436205 TAAACTGCTGATATCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947279623 Original CRISPR AGCAGTTTAAAGGAATGGTA CGG (reversed) Intergenic
No off target data available for this crispr