ID: 947279624

View in Genome Browser
Species Human (GRCh38)
Location 2:228436174-228436196
Sequence ATATCAGCAGTTTAAAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947279624_947279627 23 Left 947279624 2:228436174-228436196 CCATTCCTTTAAACTGCTGATAT No data
Right 947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947279624 Original CRISPR ATATCAGCAGTTTAAAGGAA TGG (reversed) Intergenic
No off target data available for this crispr