ID: 947279627

View in Genome Browser
Species Human (GRCh38)
Location 2:228436220-228436242
Sequence CTAGTTAAACAGTTCTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947279623_947279627 28 Left 947279623 2:228436169-228436191 CCGTACCATTCCTTTAAACTGCT No data
Right 947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG No data
947279624_947279627 23 Left 947279624 2:228436174-228436196 CCATTCCTTTAAACTGCTGATAT No data
Right 947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG No data
947279625_947279627 18 Left 947279625 2:228436179-228436201 CCTTTAAACTGCTGATATCTTAC No data
Right 947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947279627 Original CRISPR CTAGTTAAACAGTTCTCTAC TGG Intergenic
No off target data available for this crispr