ID: 947282451

View in Genome Browser
Species Human (GRCh38)
Location 2:228470374-228470396
Sequence GGCAAAGAGTCTGGAGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947282451_947282455 8 Left 947282451 2:228470374-228470396 CCCATAGCTCCAGACTCTTTGCC No data
Right 947282455 2:228470405-228470427 TTGCTGCTTGAATGCCCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947282451 Original CRISPR GGCAAAGAGTCTGGAGCTAT GGG (reversed) Intergenic
No off target data available for this crispr