ID: 947286817

View in Genome Browser
Species Human (GRCh38)
Location 2:228526480-228526502
Sequence ATCCAGAAGGGGAAAATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947286817_947286825 22 Left 947286817 2:228526480-228526502 CCCCTCATTTTCCCCTTCTGGAT No data
Right 947286825 2:228526525-228526547 TAGTATTTAATATAGAGCTCAGG No data
947286817_947286826 30 Left 947286817 2:228526480-228526502 CCCCTCATTTTCCCCTTCTGGAT No data
Right 947286826 2:228526533-228526555 AATATAGAGCTCAGGCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947286817 Original CRISPR ATCCAGAAGGGGAAAATGAG GGG (reversed) Intergenic
No off target data available for this crispr