ID: 947288807

View in Genome Browser
Species Human (GRCh38)
Location 2:228547937-228547959
Sequence GCTACTATCCTTTGTTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947288807_947288809 30 Left 947288807 2:228547937-228547959 CCTAAAAAACAAAGGATAGTAGC No data
Right 947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947288807 Original CRISPR GCTACTATCCTTTGTTTTTT AGG (reversed) Intergenic
No off target data available for this crispr