ID: 947288808

View in Genome Browser
Species Human (GRCh38)
Location 2:228547971-228547993
Sequence ACAGAAATCACTAATTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947288808_947288810 0 Left 947288808 2:228547971-228547993 CCTTTGCAATTAGTGATTTCTGT No data
Right 947288810 2:228547994-228548016 TTACTTAGAAGAATAAAGGAAGG No data
947288808_947288811 3 Left 947288808 2:228547971-228547993 CCTTTGCAATTAGTGATTTCTGT No data
Right 947288811 2:228547997-228548019 CTTAGAAGAATAAAGGAAGGTGG No data
947288808_947288809 -4 Left 947288808 2:228547971-228547993 CCTTTGCAATTAGTGATTTCTGT No data
Right 947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG No data
947288808_947288812 24 Left 947288808 2:228547971-228547993 CCTTTGCAATTAGTGATTTCTGT No data
Right 947288812 2:228548018-228548040 GGCCATTCTTGCAATTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947288808 Original CRISPR ACAGAAATCACTAATTGCAA AGG (reversed) Intergenic
No off target data available for this crispr