ID: 947288809

View in Genome Browser
Species Human (GRCh38)
Location 2:228547990-228548012
Sequence CTGTTTACTTAGAAGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947288808_947288809 -4 Left 947288808 2:228547971-228547993 CCTTTGCAATTAGTGATTTCTGT No data
Right 947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG No data
947288807_947288809 30 Left 947288807 2:228547937-228547959 CCTAAAAAACAAAGGATAGTAGC No data
Right 947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947288809 Original CRISPR CTGTTTACTTAGAAGAATAA AGG Intergenic
No off target data available for this crispr