ID: 947292253

View in Genome Browser
Species Human (GRCh38)
Location 2:228588930-228588952
Sequence GTGTCCAGAAGCAGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947292252_947292253 -6 Left 947292252 2:228588913-228588935 CCACTTATCTTTGGTACGTGTCC No data
Right 947292253 2:228588930-228588952 GTGTCCAGAAGCAGAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947292253 Original CRISPR GTGTCCAGAAGCAGAATTGT TGG Intergenic
No off target data available for this crispr