ID: 947295606

View in Genome Browser
Species Human (GRCh38)
Location 2:228627262-228627284
Sequence GTCAAATCCCTGTCATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947295606_947295609 1 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295609 2:228627286-228627308 GGACAGCAGGTGTCACATCGAGG No data
947295606_947295611 9 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295611 2:228627294-228627316 GGTGTCACATCGAGGTCTTTGGG No data
947295606_947295612 10 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295612 2:228627295-228627317 GTGTCACATCGAGGTCTTTGGGG No data
947295606_947295614 30 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295614 2:228627315-228627337 GGGAATGCACAGCTGTCCACGGG No data
947295606_947295613 29 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295613 2:228627314-228627336 GGGGAATGCACAGCTGTCCACGG No data
947295606_947295610 8 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295610 2:228627293-228627315 AGGTGTCACATCGAGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947295606 Original CRISPR GTCAAATCCCTGTCATCCCA TGG (reversed) Intergenic
No off target data available for this crispr