ID: 947295609

View in Genome Browser
Species Human (GRCh38)
Location 2:228627286-228627308
Sequence GGACAGCAGGTGTCACATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947295599_947295609 27 Left 947295599 2:228627236-228627258 CCCAACAAAAAAAAGGCAGAACA No data
Right 947295609 2:228627286-228627308 GGACAGCAGGTGTCACATCGAGG No data
947295598_947295609 28 Left 947295598 2:228627235-228627257 CCCCAACAAAAAAAAGGCAGAAC No data
Right 947295609 2:228627286-228627308 GGACAGCAGGTGTCACATCGAGG No data
947295605_947295609 2 Left 947295605 2:228627261-228627283 CCCATGGGATGACAGGGATTTGA No data
Right 947295609 2:228627286-228627308 GGACAGCAGGTGTCACATCGAGG No data
947295606_947295609 1 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295609 2:228627286-228627308 GGACAGCAGGTGTCACATCGAGG No data
947295600_947295609 26 Left 947295600 2:228627237-228627259 CCAACAAAAAAAAGGCAGAACAC No data
Right 947295609 2:228627286-228627308 GGACAGCAGGTGTCACATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947295609 Original CRISPR GGACAGCAGGTGTCACATCG AGG Intergenic
No off target data available for this crispr