ID: 947295612

View in Genome Browser
Species Human (GRCh38)
Location 2:228627295-228627317
Sequence GTGTCACATCGAGGTCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947295605_947295612 11 Left 947295605 2:228627261-228627283 CCCATGGGATGACAGGGATTTGA No data
Right 947295612 2:228627295-228627317 GTGTCACATCGAGGTCTTTGGGG No data
947295606_947295612 10 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295612 2:228627295-228627317 GTGTCACATCGAGGTCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947295612 Original CRISPR GTGTCACATCGAGGTCTTTG GGG Intergenic
No off target data available for this crispr