ID: 947295614

View in Genome Browser
Species Human (GRCh38)
Location 2:228627315-228627337
Sequence GGGAATGCACAGCTGTCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947295606_947295614 30 Left 947295606 2:228627262-228627284 CCATGGGATGACAGGGATTTGAC No data
Right 947295614 2:228627315-228627337 GGGAATGCACAGCTGTCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947295614 Original CRISPR GGGAATGCACAGCTGTCCAC GGG Intergenic
No off target data available for this crispr