ID: 947295663

View in Genome Browser
Species Human (GRCh38)
Location 2:228627759-228627781
Sequence AAGGAGAAGAAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947295663_947295668 8 Left 947295663 2:228627759-228627781 CCCTCCTTCTTCTTCTTCTCCTT No data
Right 947295668 2:228627790-228627812 TGGTAAGAATGCTTAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947295663 Original CRISPR AAGGAGAAGAAGAAGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr