ID: 947304460

View in Genome Browser
Species Human (GRCh38)
Location 2:228728404-228728426
Sequence GTGTTCTATCCTGTAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947304458_947304460 4 Left 947304458 2:228728377-228728399 CCTCAGCACGTTTAACTCAGACT No data
Right 947304460 2:228728404-228728426 GTGTTCTATCCTGTAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947304460 Original CRISPR GTGTTCTATCCTGTAAAGAC AGG Intergenic
No off target data available for this crispr