ID: 947307684

View in Genome Browser
Species Human (GRCh38)
Location 2:228765327-228765349
Sequence GTTCTCTGGGGACACCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947307684_947307688 -8 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307688 2:228765342-228765364 CAGAGAACTGAAGAACTCCTTGG No data
947307684_947307689 -7 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307689 2:228765343-228765365 AGAGAACTGAAGAACTCCTTGGG No data
947307684_947307697 30 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307697 2:228765380-228765402 ATAAGTGTTGGTGACCTGAAGGG No data
947307684_947307691 -1 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307691 2:228765349-228765371 CTGAAGAACTCCTTGGGGTGAGG No data
947307684_947307690 -6 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307690 2:228765344-228765366 GAGAACTGAAGAACTCCTTGGGG No data
947307684_947307692 0 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307692 2:228765350-228765372 TGAAGAACTCCTTGGGGTGAGGG No data
947307684_947307696 29 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307696 2:228765379-228765401 TATAAGTGTTGGTGACCTGAAGG No data
947307684_947307694 18 Left 947307684 2:228765327-228765349 CCTGATTGGTGTCCCCAGAGAAC No data
Right 947307694 2:228765368-228765390 GAGGGAACTCCTATAAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947307684 Original CRISPR GTTCTCTGGGGACACCAATC AGG (reversed) Intergenic
No off target data available for this crispr